%PDF-1.5 % 1 0 obj <>>> endobj 2 0 obj <> endobj 3 0 obj <>/XObject<>/ExtGState<>/ProcSet[/PDF/Text/ImageB/ImageC/ImageI] >>/MediaBox[ 0 0 595.32 841.92] /Contents 4 0 R/Group<>/Tabs/S/StructParents 0>> endobj 4 0 obj <> stream xr7*Fc`̤\hQ;^G%S(g)gs7v7 ES. ~n=~ɞ؄ G-ac;~8'tz0 88kTKy8~bN/7Mwq G¢M3ᨶ\̠-B ;3SUUe ffu  }kG4@0R+!~4󷘳;1;YC{2q~%2|9{\ͼ Ts,4P~k0c$84M<8)v̪²3@\eCGp3ݵcD2<2OWHBD,%|Ь((ox K;Ii|e.#m#»"r/6~BIsUT1 Vt.ݪ,N]Y孓hwfE_0)b/FHI- +ZΔ{‹RSrxV{i秨Ldxu~[sLQz^X.#8 WznٟnҶiL*T*%iycܚx'tcQϳ2+ǦHeHU"\^dZ xVx& >+r-zHa5xReEbU9.SqxE U*. ӂyB*XYu@uQCcsn4\FFnZs 1}&۾CChyes ! [Z'ގޫ[Ff/"ïGRx#DΔӴ:Ŏ,vaӈE t}\'a꩛ ul7$rZp]z@m#m#H#0c)_g@ap bD!(̤"':+d$k2ۘ+ ſm 0 #>En]T3to2t1]yG G`LTV"t'Q\YBGf26 DCNxV?_ aC><A=>qDY]I%9'Vb5I&ꌋS> j]$@H)>dIIN0qkaLƌR`6}sLh}Lu;$Ѱ4"5n8IΧ+r)ŝh.CO"8hJx%e6㾩ʮHu{  ҫ\,,2AjIlR&~#Qwִ)D,؉,J=wh+k|BU8<߾ ȡwXZds+ 7Uw}1]q{'dNh+ڍ;3&P`R'"b&UM*8nXpNǻnO#t([`gQ?@5d]mmGoom#Ĥnd((MGtk؈80X[#`X;$y]҄dI e.B^6<8Y2 u0Vr.W*x:Nkq9` t@hk}U0 |p:C\4)f(/T @)y+,&!rΏsvqkD% Il3!:%Tal9fƚr*<*;ǬZ9wQfW-E* c|ub1wy* M7?昗k1`~{dd)2(1`lɫI1~;:"I0ܗIG>N_#y;MO/쁐rTT Qܽ|V@oV'2r C oI".MojQ^Ipqŀ.UKL@Qr%8JG{?6Y <Ӏ[ZDW~fsy~+:Fe7LJVx G_n˛_s!ܽW>d:vUE)8Lo|YoFC?G\:"||ʩs.*?i,4[\MC< ^k ;ġ@-1 *٢+ 6UisR.S~7?NF+Z2x)$~7 ewaԐJmt[P;fPzAA-{rZe|/GxOxAܣ+$"OWW,bW7/(p쀺uI:}.v 6(mF- 8:A_px j.iPA}#ՋiUu&쁼RX4uht|=>/N ud2VSl6qm WWr |+XbyVlZi9p;JJ[IXHQQ}@# $|=%0Ã)o@KgIWkN(:Sx(_jԤ,Fnk=.2kYQ'd}C?bYcZ2dZ'$=-] a;FEv;^ͦ1*ւJeVBodD[_'ܤW7쀾^Ej?S(ւ6r$JVZ"=X;F@UL|+!.ݞ]9k2_8n ;-=Ɗ· z 4. cBt&CZn_X5Y ־7/gk#ȵ"bD7#bc8zpaq:g9mԄ":(αpP4&W%BS(vVΫt$,jyf)$~1]>_@RJfC| w]tIXj6Z/J/{0IKBPnm49\ot X Qlf+mUZzN'ԩs endstream endobj 5 0 obj <> endobj 6 0 obj <> endobj 7 0 obj <> stream xxSUǓEW:&M YŲlQ@ j Y DD*{ HsϽٳivRsn/?<%9'{{=罄oPS{9+g@)?L"=mkUIɦ,YOERG PSDe1=>$ʩܖ7Չۡ{a%/:;Wbٵ k=rf_=lX*+o>jLMq`|:L6z/-Mj"䖴/>#'a&p-K_Ot`L"2&v3wiq{ZUF;(iY7ߌc ]C" ZܞV+g7_󾟑1NON^YC1PmI1-~v-{yx899}ƴbq;tox^T >wklYI'- v_䴸1X_0ƨakxj0Bs2jslAI aƴbA͖1NI+87ˁqʁ}Y>r`ܬr`l90nV907G˜O> [qN,@[k,Vu,s+jT2ݒdfTf}Jr`lc7"/_MœBbLxIZ*ˤ_NL-p~Qx@27֘ '4w_ ڋ+ŋDC=,"LЖ <Pҁ}T'ƀ=~T-sEabRv͡>tqʍ;.a&~k 9Cg~%|)xEa܉mk:}ml--Qݙ’-?FLLxgVSTRnA15{Tאc^bS\g{< MxlµGRohHg.ƃ)ږqڃg-~ ,^eŸju'@x=9Ed<Ţ P,9PcԼza|T9| \y*RAxte@񺭖K77 >` wqścT?Qh j^1Vy0GhlP^{fCőW16FiOvڹW0`IܗBjм#;cwtӗ`\aS?j͚1yhO_ęśyoxog7tcȞ.&;VIwX ` x|[jr7şn6cnu|>B-:0)<"1K\l+Ɂ}d7^ V* ~vCEʬrr`lՉ1Fѝ^ּ,I(\Vw#[7<ʨ0<Ƹý1޸ kL\!7.яGuTѐ/א0`kѸ)`J~@5d:U5Ox4 q3Wl?Wj0ΨF- 1`9#E#_+^I1vcΡk^QT0Hk50oL (t~&-`' 8GWT7:պՅ>Ykc<0ls4;_{rl'F#ׁ}dnнTn5:{tEe_αIr@vuc\<{ԆQktCD%`_ 5t?:E+>CמaOɵ4QAet3$ϰXa)9_GoM*^'͆8ݯC A?YC<9tRͭ =1#!c!H1¼#C)Ҡ~fj*2 Mai[?qD8X{dOjy'|[lSI6s!p񱋘[8 ݕw?$c䉹@b>L"Aoh+WRD.4jgwS{^4<ѓy^$b!@GφՍqhת-;&۝\FwX&  c^+k:8\;$?1\ΜFl]]گ»a>t A@m!pЊ1c`C7LWL\a1)YDiX&Xk8I 7 (Yp({ ]a?L'qD@Go*'_q l2ɃΒ$I^(52b!<8 UjOLk7x Ã'`%(I;%"0~PASw꿿9EY#k_sX †D֞PazG [KKuc4p^{2tƚ c̙|M^$gV@ȩ(Xb\ܓK﫻|,1SW|7]QB *__K6)n `"\{(2Љ_Yό j4k gbf9 zD/ҢeI):I<|j/{bt7xL{ߪ}A1ch-]{b_(j@0(T!3!S+f~8a-L񬅆G``bF(Yσcx r&*m-;+:@&+y@GՒ|8f^{hŪMe[ZBڍe|$8M47~bq'|wP'Gw UT?ǽQ.^l7 f {ڃD_-.8Q#{O|ŚC~ κ˷B.\kU|r6-ڜIG.+f#.d ?W_N9+nT~=NK.0{\ L&h<'葏QhpP@][czm"f߀V݋j\AМ|GEh2ڿNZ?z1|^1Frex&{JT% }ۦ" Ӽ Z"4;&`lÌK'4%I!2q_f W@IDQi}=XպAWł.  c'-,dW:](k֎Gߚ?t5hs&mrp7GU#*fcȁqʁ}:1>lyU3Zb(^Ý35TóaCև1Nevh?Et-=cb<~}Ѹ8JM_m Zè.}ZJUub c e#xTGeX~@Q 7\Ut \c]z?["//֯{4ݔ"90nVՁq[lJ;O &I^\ODp*?y>J*LQѪw2/Z@#ZlCeq#c*L ܅5aKEc2nF(BY@@p0q -k1ariysj<6Ҫ+j5UGYފqUL:s w̒u'\ ܣ P6VHp-!܉V V{E˨K̫( J\ט+UL? o /\SR<ȭt{ŤH/gF#4Ƙ֓481v8`? _pRV4p2Z(HebTd\ȭ(xi{pQuu5c[=#Yk9p )(#g襁w FOxtQ9u_~/7܂?/#kBu#4Kw\}~lɤx]{y+9x}ǍhTsZ{㮹((I\N3d?Pėۊ*m5C)Uws(wkS}GcGDLZ1y" s0_Z/asHy]_4 $ѲLDCD&?+Qe)N2míF\ 1ҼBP"4/Z[s )lGɎ_;=,{C?ǭ K]Fa]H^Dx߇9cMp]qժ8c h#ƂLP~ߒ/~;&16Ţ }+sK8W~)2Q1^T?䈚{"]9S7[y&h ѐ-6RGqQkxܛDt*Mނ3p}@][2j:Ƙs7} ?=|F:u!*Kbl) E.W^<0tXzaoGt;2HBdoo1}p%1ĹS%# OfǫwWz\1W=rջAaKKx2 bd9_Ox˨LbăԿw AH2$s SйSTCQ 8DS,7!$1|G4r ?iZ}u#ƌrw~FŊt2c,_s1 P6g /=t*$܏$ց1]r0/҇):to@t*=RũHȆ6zyB>N$䅉B܇^/U}G4C|cŪw-_os&ʆxT?+"-*acVx"0(_3 Y|#/|V[#iJpxZ*M2q=00{ }xv8۱QY0 K]A"6 C?S"tC)| P1Ɛ[/ ĢɊUv@k+-OBϮ4mhՁшͧ60&na/~@(ASd&gp(!x%H>w%W]7Naj0\9.]s>--f&ak^=_O A]ywBcr4ԝ-'wQlJ$v'{PǢ!ͿyY/RraZ cE swJ٥;{Y8x,AO%Xwj s%Kx̥q#wQ MAdKPh4SQnnמe&\BXI4d ܌wfB%660NϫlϞ %z]2]Cgm1(83|=~}8 #0Dnd>zlxQB(oJ%}x_ 5./EC_9'hesaNjG~hS0sYl=([P[oQ_#ÁSEM+8,H\ƼSBWn\EQܒ^ ڃ )+ڽ[9aO`˷uМx %\h1@Ȕ(Rh¼}(ͪ 8 HU+j1+^=T?uA1@Wp|_3r<09o I^qes~q:" Jd¼ 3{id*dKP鴡MBSC8x s~B)8CjOUe"6a]/,L@bYؙ_j}n7\WRL(T]Xj孑UӴ)gS!ƩtQϗ^mUMSaZ,pmgLmF[D nq{Z ӻv}s|ˠ84zfz :7< &=׭'lvC{=U_EMys:v4X/k?[w:ywg(WœVM{WsءgI}M)79`焙<st>.NN=G^q4泗3w䙰XkbXp^ | -![rOFOBf>`ޚ؎f  ?~A!a?lG^3xg*/ރqq>Ƥa# >KC^xؘm1gƿ=>W[ȏ٧`(?wv>9F_?d] 5 Ta8EE! -\6}aCIGry?A90vȁC@ aV%T$RkkƴYx,m-[3&Vź5rUNbuX -٢I5U?hD"* x트G[.mQ|H@\,ܧ\n YL?Y`b' tRz5'JӖ{1Vm7ʻ2WI6ww@m>YIS=+݉{T_ҋܗ_U؝ ^'_ݎg_=q;_Ys"IO*%pN(kjضn(*MPT2 I?#J#=2+ԳL;&#F!1HFcU.!KIe{=96$*+FnfK+l2O!Ӂ6`74Ϫ:e[p=;x[?]wPYшiAck 4Ko+QWa.͡3#ǗlQ55XYAӈn4OOJBec ~A> v|zᐉOÜC!~\;?i &=BY9q)maQÔ )csUs0rנ3C ^j%;V:idۀJ;YE>ZxF)Q@%FW<),]yTGBT`.<@Q1j4y5D B"Q rMbD7Nwu\0tnvAM"f߃WUW}_~5Ba;A-qE}>^lḯ93XR y%+>RRۤV>NSb +1GHp J:Tk5Znm{Z$RXnZ.~l%{΁[F%j 7ﶜ |8rDl,*.U'Ni-P2RwRqI2<=q~jkݳ^ŝjdتz/Z\VԠ!riknVMD<Ӹzitg9TKtT"9XNH'>9Բl%P"_T fs.h*2Aܸ @a)*4$yBr$SrodkrM;p9@4 |BGRxﱇN)0w(x#'i(LK}:y3%9Wغ#TQGNJc)MfcWtL*~/T ơҍ-+@I2!N\@\kܶH;sA[FG/pMGv{dP1}7z…lxoKǽObܺ[| ^)2W FSfX\qF ;C~D ޣ0)cٚZ$CL4!q~  !O*i*/^k`#%}%WH 'z ӮJgDG%Q!rԙ0I`\]#AF*,ϫ΢ 0PRԴ <<|a&w'%¢ڬ]Մ{U\Nyſ1y1s :U>дRzȤdO!Edܩ_ $iyuE۰[0 qBҍ($Kfk1<aj$ (b`>v= v\{TBP.58֦d+N@)N-4rsi,Jf+O>O*c"?FrGݺnRaxccK2u4`8n bk*6rN`b0iL|Q;ȴ B R;KNdcd?Xֆ<$EI't\&DCZ~<AĴ5ԴvN *a{ 9f9{NGn? dB7&G!5 skMrHWUoXEŔuH$xlv@&;O80 g;Ď##`$C=0Vg>q_ɝ^ֆR{:Bb%%-܉ܱ&z-K\ئtY7Np_wP#]bӍv@5ni{0¤nک_J=Y0~gDWwhq]7#5:>u3ưxQPi^kg]hQ{g/3wW5bIL{a}9ntC5j Z06/ZK!loܰk^H0[n}(pɭ@B:K)aWu[ "_d+kށ&\`:N|q'm ? .mL+l~K)%uwOe x8y0$W)I-JRx]p2 sQ^4B<2[BLt:wx`vovf})i:0g)(!PN#C2lXYn,1, $ئ4tNoJȳ%3>\_S#յ-;uށ^a+hDmּscUR^ۭUc'#hUj.ls֬g2![߁TObA0.yu;߀ m1r*q 5LBNYMeZn30IɌp]9¸ҥ|Wi(bnv1wV*t(&=;OEbtstt*3r  ;VUF.n<* "j<9x\q˒Ք3IE:q nG )`FM^vcd,_s_ $܂ah zGP% aېhG{+lBa>0rf**@Aʝr*4޴Ұ| I{|ܙa*{1&q<~iX~_,[J|-%+̕ǁ+(CcF!x@t ըI@hnͅ gx* ڴJh5ITPl9T@,.` .O(DBupkIu/G#ulu:v&][dX Hhf5̸jr$Nx K60,T.gjYJV6TޤNf(YK8C!c[րUql_H]Kѻ(XkgL,l)x<%|JTN^bܸ n@)/]ɚ? zet@"M׿VfSǂ_N%υRhR4,´rCUlZ4nGLQ#Q1E ȸ4QzRN8~#uŇFWhg%ӭ+\?OxӡXRjp? N7e,aD !6c<3&Rv=:,%/L&]K/zgSr [ < )3do⺽/㌷goHȞ"NOV w<  ;4]tȱY.&/{MOV xҲ.ԑŅ.;=[x겆'/G%&]0cWt~Tx O+B`_J')nELՙQ؆(=8ϴi)cDPb3>q}m-:[`Q;ӓ7Y[d @ݔ]øt?m=roǧ$?tL&u y)LNu+t2(hho7$b|2u33H𻟞=z,ϝu8ʭ[y /V'-ۦ?&3~]˟cGkGJ/470' endstream endobj 8 0 obj <> stream x?K[aµ"8Bk(,{|THM[%:e!C,7"N%A)pޛD |l 7Cekc>>ŲR,+ŲR,+ŲR,+ŲR,+ŲR,+ŲR,+ŲR,+ŲR,+ŲR,+ŲR,+ŲR,+ŲR,+ŲR,+ŲR,+ŲR,+ŲR,+ŲR,+ŒyF ;v>tt{ʪdaz4 xg;ym'GfdL7kQؙDMO o3v;a3>L&{ @dm$&@na.}gCӖkcmn^q̿:"""""Dt`SW>.P{H<>qex?S>Q+I]߽އyde*`յ endstream endobj 9 0 obj <> endobj 10 0 obj <> endobj 11 0 obj <> endobj 12 0 obj [ 13 0 R] endobj 13 0 obj <> endobj 14 0 obj <> endobj 15 0 obj <> endobj 16 0 obj <> endobj 17 0 obj <> endobj 18 0 obj <> stream JFIF,,ICC_PROFILE ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋICC_PROFILE }xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|ICC_PROFILE } "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{ՑICC_PROFILE |{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmICC_PROFILE jmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"ICC_PROFILE pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:ICC_PROFILE N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$Zz;LE4)A.VI=h#2ӭ#}Vn<3c0?OpkoviȦ*@(}F£nR"J.gxK r?W y߽-߃ʣ{NJj9S[:LoX9b7-CM51jl]2N+a|WԣЌ|,X:g7E7{ZM;E8q 4l[W=yZ%#.-_f@9 -EV>u[B;iwb{ ~jR?1rwim &V7ְzT2kqb9Xb2*}[\rۛ8k3O[x+U>UuSnidVԤQ\ilve n^Wv:hGKi1YZ * [\- "5̍Rj "ȉD2ҧ\qVIe>]hGdFTqa,a-$ʗ\XwqZaŸW1sMe[6洭MC1 rVw:%J0U7ǚ $ 첔NDYɇZx\LJȩ!f{Sst$vڸG44QRWTբ1TQAC#BqSAm5Ծ\|gn6!#&;8,a\yVif%eL8n$p[B@1du{[y+Pghw'#kqc.4;oB;w0xɭ7$v wM%ܑa_˃z1޹9qEym4}wFJ򠎇=?Џ͍uu1elw8剣88ѝ-fjJS $ꛏz}x猑քuo*K #`~q\ΨZva’[!pN@,MW9cg^hW@̃0?³GJu!-w:n$ǻFG@SeN岻yOMk9M 2ygi8)֍FѮ:1Aq ]cˆc*ZClw.V#cVߊziNVqZp%"BH%sZYYVUi8j3·)*Ԡ+֥SX)sHnl֐h11QҼ;USvUTݾ%iӧ>dmVd-itN@aF;Qw~Jʤ#JqM]<ҞkN" Yn]IXe'r=ZKj*9MqZxpG28#KIr0j1I+."csAEtҕՎzdV@I⯁֓7"V4S2{Tds\LCde,)>bt=3~uFq@FI9"WW,]kpIѓZ̅ p@<N$K)W2Iydy1P1,Un8K}pO'KBw( _kKJrzhhi]пV;H9 lW1eii>pȍ3I3A cM٦Vꕊ2`Z@ ;Dj8O*w)S)/rUȥ:tn?ݲQp}7#֙(WD]>VǥA5 WT$ެd$)XF(EmB}i T+<~x<F \xj!oVVܴf`S 6FzC}hm.fYHqpі]-T#%睄5Zwy`v8%Gj:RMLU[NyfB K c9WnNy63lb <7c2XͼH+qvJW8 d_fv{O.QSy<2NHcYkIV|I#t+m%טֱ KCtHER-MdEr)j.CHgFp9u;@0?ny[5Οv~ItcXI::7"B4;{ uK]4RTud?UiMV84FKJ+aR6EOV!? u09 GZzT#J*X!ݪ]5RqIRIKM4bxFKV\<sD"´ (Gjw4[) _֭TX~lRњni{Pi-Uof@:S;4u )(dUy@{QLP]FXjRh\!ubVin_btl2V.cC@Xk#kbzߟZ%'Ѓ@ 4y%!zPi(͚VH^:ړ/!lqڴnf좸\3)f/nU5B9晝XbUUG ;밶\+-'뵳KTUAi<֦#oW?ve\g @ErS}ߚ7+4.yf16g*|Ic3WݪZ;,Msz-уQ36~J|%Y-w⤶zJף/k!7;daܿOҹO~*)kbo;|f7c'ґ:a DƣM>>\kkQ:+6 CRQ)i4U"daW-YsL7\U <d858AJ0V>w {( Ja5;JHY[j(.$1T$yr⣕2)̊uҵ_f|52rºiB5IXT\bj{6VS1á\~mĆ⸎K-QJG؞‰ mW) Zܹ:pȮNWFkUY7 5b5͠T.c5v L f%ˎUvyjᒳur΍iE |V577wi2Q|`3B)`!9T[o jW[Y\7pɼk3M+y®Bԩa, _ԥ󅫢M$k,qd2?) 2Cgjv7ٕR7ZB!uT+fͽE )3;n<լ/]ws7 j$Ȭ'8$}lWip8S U.+ 14R̓a*pTmcҔ"m'ZH-+I?ygX$) 0 Yzs(AUaT]D,P8Q^=)}bl$V%@\rqsUwFx9eS$#?ګ/r9tSRy>JMzN m qrOA]ݕ+%Yr%X`# ɯEbh(VWFu1AJ@q\wDġcE :: 56O6\oFGLmJ>[fj֡),BVYun_?%U3S[RRB5(ƇqjzR3< 8b(ΐK+%/X BlzW; oR;"_E* l\I۵sX׊-`Z'$ [)WЖ@j+V)HZƯiK4q4(b$v D](xDRE!E GeIPdZ`5X?Rk¶ʿ0WbT82o~U*iFkM}Bjd:N/ ]I$\Zr>? ϟŨ>&,ˑxf?j+?Es6v -禃;Zyp 'x?ҸEx\gqe yg%쐸;gqGoI< ?O@0\:Ԍ57лm䉞ݳ$;DS3q5:($P  GY ylH$)aN21+}]1צ>­u=nƓWDX)#jFP8'56+N*WET31@'zt0 ǮDDewOB{Ӵcm._nc=>PxHM4L4fjy֬1ڼ֦=&.HeXނ@&{r]#F@4!Uqdӡn/ÌՍ.Mn% V!jy V!~Oǁ5YʿJpCEҒCJLh4撐sJ 5S^IIS;x+eIu2u{B:r*t2.k>o§ U<̵`ٟJwؽ]:tA!=+gYA$r#+)HTku-RLM ?uu}Ԭ.d0qZsh:'洛sKelS1)Dm*Hb28P3M (U5h>n/nBAsG:a tzjQO1D8hXOE:˺64XT4\HTR pHFNkFbkrŵw,[,FAgJY$i (eY5eAJMByOХO}EYH꾂TSsZ:EZ7V*F;֕qڔd܊E7⧳=E/SSY:,ПI >'bbǃR2=YjTv9ǭL ¼լ[4f5u )( dVmЙ5xz"95t°mqvM6tg7^;e& dbx~'Y;gsgs ҁ"@6=XEP6"(; e"ibD}MOk>LڴiVV |͚Wp\-"Uc.ٮٴUK5=y ^|t`fT1քobG}K|퓴T3n~Ir%W+[R+J5ɮJ`7vtY+.Z394n+,?Zԇ< ]{'Ո!<֥|)X"pثɃTO Dg {H5tS. j)N7+nUSxLU,p+1]ΙJ2V&ҭL~OK\*8Y-3OjKhQ.;\ufԷCѡF56-+Ȱ푬\Ȏ7 =uw  j9 du4 h%  1@OHr9tCr`xH6@$@ 7oݒϟ0zlbswe)V5qԩֻǚ"\;R^ZG9 џ^))*G"-;2Vs\*N"zqpO&,;Qp>*5E6N?Oz~qǭ|it n~J{U+]@TzRdY Xb28PqO@?:MN"B Y@ 1gՋwFNN>?*!2`@c#^I3 !>2 8%מqMO^v*<$BD?qPy$Ct 4ۀNG)fQt_;wn2 F kzT{Kwfd0{;ha"HԶ!B_iJDdđ j/&ec^0 㟺_jesqڛYbX!1;d#fuphyHrCA#֒m*YQܡ=j ^pp={חFN3GEuMhL0Xڂ*{#׾|yzԢ^0}A9jjjFQ&iƘiN_)3T.Qom *]lяH dTmT ȫז$,Py -&WH88) vcdSoɣoH6S֥߯hɪNg_D&fؤz>tۮ; ūera\d^( v ,ގ[v:Fz \SZz¨rEW!!H34 bG;ֲnsW'zɺ=it}.t*95̹ ԺH{m'wXsJ<`T{"IhǦxqHPjQ4,dMգ+/PC  hYɺ-3D-XdB]5B.𲹍y]t "͹ZdpׄybCKe{W.ys *םY@窹]33Ui4qvN6T7v*N@wIL!#ژ҈,}3X[[;7y'#O3]dRii x$M0ʚm,?yIa{8v ȶ0rÃ=*آzd)~Mq[Hê$vaUǠ<֖{kc脙'{:LvCj$2)ZѠP21Q>]Dp76t՝`TQQĀi;1ʹH*6 VAj ЎOZTVoUgKEpw7b,%>q L6"gqW4uYCc& O5eec6#lOoᬨ'VepZZ~m< m/ytݤ{278Mb@y4VYx[iEnyU|Τ2:`TE d:ajH7*>ܜ|zc=sU*@pH G1\UI4RX%|y #p=#wf!sz{.yʶ}`1pzZXFpIR3\zb=>R.HE ѡ8i?#'܀;jW6A v|7 en2T4}ʦW 78=_4!7PS6. Fb77v,%ޟdV4Fsd2  #AAR3ZZhcXOr}vb"24B@̌1Ϩ m'#wWCj]pnqWOkke?)R w:-U Z ܯ3椬eS uS?5>x'P&iǭFƁz6OJt&ŃҼFL}Դ=&YV[-@&Q1]<`G\aǨfjZ2=w/.&R .RL[ ",QFqYZ;df薪CFzđizJ Dݝ^~R(+Sjjr@"NhihkԠyd)P1:tZ[v 7mM)IEܟv7?J#~} ۏᦶeiVg;#Af< n_[Rx?©M -/'7W͌ZGoj6*Jb-Ҥ{PBTڵ>+͊Q5nXjnMG*uiK-A[h E",zT X2&o 5BN/E@<I,jU@'4 \R`S4!))h E-%Y\c-(H^/5+6&h3L 5NMQ: )iEh=';P1Rb:1 s֊_4ZZJ@E1Sf҉XwhC))<6JQL;q~be@kRQ@ȼM0jc v5dJTaj6X DF8W]WVT`3nskNuYs03nZ|9e6I5F: #[{EQP$2/RqVGTy%EUHbPvm\zݱUj.nO3$;`Vfd5чP1SEp+ϫUpWd#\RB'UX|ƙycTcr VzfvXsu8cԼӺ09ZSNS)1\?L׹skZdW4R'͎ k /S h{{yt[g#O$+P:#hϚ'Z$h$5hLjU`Wmu"U=JE!`zW5I5vVa4FvюQWhPx]=jŨk{dfF0g1mVO$\0*shk2jM({5rSʎ -^ࣚOihtz5Oܴ͋:N>fW 8,:ԃSMF=:WO%YD680:>Q\Fy.:SV[|*K C"{0Awѓqp~`X>}+MƊʃ&pd~g0nΚeA<6Lc!s pf%r0H㰳3]4l= rIV8hY'sc~FWg Iҹq5Zw3m+!T#Cf=xSӜ#gq!T>9?Xb>Z#EqR_ *[۾YqƣI-LD p>oǯHRMBC }CӡpDV#*Dž_Ǐʌ! =*Y$kH>@*_..SrGs229ltaiUwafhZ0;־wQZUE* /5sMBq|4C,j?w >c@SܮUhtBS(j7"?*C4"G)Sq#=3V/A4;Zl٭QL-G!eS-l-Vڀ2VڤK1k=h=2n+AnH8q(L-]ӂPEzTVS S.#Vm^tQY{R@>AS`GSҊZ6сKE?ժ/_!ҟLJu1-%-QK@ 5BqJj}G4uz u5:S途N4(1F)E.*Q8 Z&80g]G5ִgy4(zRKE- RF(Q@ñ i8MC(QRU4E!ZRiz6b71 c TӃZ\DEKIPtF)JSHh0HqV桒3ȹTO&лL)Zoc@(;>a4GHvl[*Y@Z8Hؕq֢.:<$Ю2 ԁYSjXIUS\H~D5ШfD5u ;ERJk3<ꤒVG5Vۻ'qRI+D(w"cRvD]?oS4_Xk2n{nm[]zt֑pj$檭dE;jv^i]VR,QH 웈5mn-m &گYWoЄkCf:s]ҩ89cvLS3nwaQI'J  Ֆח8=S:"+Ҩ `gz5kKtXːk H[1ylRQ|-#>̹>a<0k>@ED"tlu~enivxi=]qխ5e{z8'f ߹JC^҂IqPXV4[zWE[qIp*ߘVXekٷ:Յlųk`Wpr8Ⱥ@,W3Ss\h?&?X]:Fi6s֓ p+2"zv+O# kȉV {9ln{w*B= aݟ.7LhO g ^.w=.XmQqo>EmnRxz6;݂3cccݶd{֍gf5$i*okIڣ8N3fn(iO (څ`f#:naǾ92̿PyNEt%_:{ #K+fE%^c+v*SB0\OaAHfym;C>gl.FzGYʛ~ӴO_ʮЧm]"Wtzk? >cmadrn#":iesйq\'ο\Pćsw3JwPn?tz]eVF[Í"{v0o#RHq I8-I!)||0< 5zO7qcwX#[Ϊzvu3|{Xq`r}M^o.?^+H;;^'r=jQPʃR8E?-MUP2^S)}k><\ֱ3FM+ӧ+$kN SFޥi7Iژb`EiYg\ž-˕8]lU ʼwlU?ԚT\vcK$&[sY&bdW?9(;- &+FwW)5˩$skGN۩G4;KXopx:wQLe9ҾhX0Ry=ԼVޖ7Q&,R`~_m|_QI<Ь^c7ץas)K *#x~?N8`tm.!"B*0ۛ7 ׭j+X% A­hluVlw'NWܥOrӦy-$dȩȦ[,#x$17[}]:TonPƷ ۷sIҳƇR9mFr N62jw+w@4qtp}+/6@H!RѧN|bny7=IR0iLVվ n\'rX䜬"oŀd ҏ&ՐVfgQ].W?R {cz-=kjFp*1,m٩ CJ0j ȡ"8=F:-(y:PhMkim@Ms;$plf 5Һ$?&POܴJ~HǁJ"آ\ޟA T0Ty397ƞẽhٻ}G9Vnkñgv=Y8O%T9{Ӝvyi!|`8=q*J$Z@H|#UHI|V<Ux}'pGLUƯr'qŁY"| tGwi`/`qZ=͌&(!ʐsϵb}KiTHckTԶ9$tg#gAGmLnI#A"RG֥e E8u'ݧC@NZCN4ZO'VOGҀ$RRpܩ t>Mګ۟1{)E1 EP0uV_Zw#e ǕNd8P,O*m:4,SH9٭ ԌU0e,1E-ํ SG;Sv]WORթ>bOsUu#?¢p1䯗΍?,uiQ*$<X"B 5Щ f".uzsɴt9Gt<+eA0a]0a$=Et|,b7DnVfPǭva6Eۓk11C*;ZѢڻ2Vc-桖y:+)moXܒF0;:=4#ӇXK^;$*rx} YSB))\N&T1="%te+|Bn@}*1,6a LT*8dW:AJЂx5Ƴi211wSZ;V-J;){0c4[m@3cՀᾣ!QVs4jLRhބzO6)⻹9OcXY.ֱsSSrx16>ҕV|MYO\2Tw B<^[9)LraZP`yTIfޟKͼno|`*^|IN9}+]|cw1[BVf!̮u v0 j.pq$ Ih<#2]"}V%c_3s}5̓H9hK&51jPv&?s͏<␴G2nUu6AJ)h (@%;I@iM }\?r?WG'@wAGYr}#UL0c=@ R*SLD[*TjՐ =kyMo oc$?-@*gPc׭>)RRPM#tcP#/Qohj?t~ ?JNԷ_JOqQ*C֣SR6|UemUƨׇS}ԧA㺢p⭥1^]Eu"jwٔ*붑"Pbltܑt>[qI xN%8nr.IR iif5e]U]-YNkHvqrxv/BJRv{VE+.>:`\fבVWR-4[`ÌC=~u Uzk-IVgfj6mLDA8 ,7mNj7Plz`8EkR+;;K(|Q˹\$szU /)%SY2=ҹP~QZӅZڀ4aol5Gc{NkG1 ]bu_2|⢫iN7g?˗ldԀ?V5 ?JvNvΞDcy[5_jְ""E9r>3hSR5zhԴ۟.eʜp8oWn995CŵUkj<@Zz5‘/$H}5Xj7X5aU{oᔁߌzٚdNa7 VШfsԤtaDj{)!Ȩ+cͫj`nbGz[jڼPxzszsH8\?u\z` Wa$ܭm.ɢM޵S1X8I*Dn1ij6-4d&n|,]-cE$幮=A-,H$d O~{5CsvFCT4)ښE-ÿava(3 ~1qZɬ\m_A dSDQouQ߭d1J 4s"~nx[V@\gQZ$Sw;@@t Zb9wns}IU P 8[i6 L,HGnJ $_ AbjyHݜv?t%dV {zG Wg&Z^2Gg5G9aNUR`gu. 8j1UiS9}HEE2 qfyRSK@X4sڬ jC/4 Un;V*0@RӅ0"J(UXZMS Q}R1}S ZZJ(hE SWW;UK'@TL)RPQEb4Jg /~$0Kî}uӜ%y㴓I4˫ϒ$$ըuPVQ=E!QOyc欧5Q\4qUnn?'4f=[:5X0_G'W)9T{K&+KQC 5`r J*(-n) :+ĖauҸV'3h N\OFиbcRF)(@#l3 l4_w5|?LiY?ڤdomՉCU3D(PPJSM5:~G}ҮG5GGRrݾE{&Ѩ.ܥj`} p{\45ڹI:VǸףϓ摗Gs1 l^ɞk[r8[2i%n0uud&md1bd:f;ՙuó1 R}f\s)ii2+&M͸Tu5oBLddoQn~4o7*(|z]/9M]JƷyG /su[oy wzuzGAZWD9cnR /֦W-hj!*rО]lyOU>廈8;Qu 68C\))]G\ٕbyDWRUeݹ'j_aSֶ,MdwwPl?^՝(dχ󂂣g򫊴4:[) ګ1'׊g4ب,ۧĝʌGlkФ\_ˌ( BriGJNVVR$pI D.2qwDV:'cַ` 䤀. :Qe-"SG^j;j+ 2^Pnq}͵}6M/Pkfmê>:VqnRӡGIBR)TM&B\}*9`*7Y`;+X&*+Uf7(0:c\ zu!q8܋{yC.9{V5-ڈhjW%=T][j* yǷ?\*rLSz?ҼS^ānBx~BK'yNEHA"6)U))lg8J]]*zj-mTcxWLwH"2v 3k"ݜq\敪=îEIk'+?ðu#4cgl; W-5i2s)IBcV֝t Ԟd%g²>Qr+ǒL o t։.TNsm#!J3[F.{4>)^? 7VwV .䄂0hֶ([^o NT5zW;kImyK&;%ƠG{U{!"#0lwi@#?qO"\$gUC[n1[3µPmXۨIȆ F5 cSZ7sVɠVYXQ\̃rM6HLUҠ XR50})ږ")i)OJ?oOMݠ iE%(bZ( =*)>1oS4Q@RiEU.֭U?w@a RR`-QHAU/?Ե[@[8XIKI@ EP-Q{#?JyV>Ƽ*S?JzJ1F(杊1N*ݎE#ҫVxtM$p*CL D@P*):RR݅b@|Tp`e# |}(cIq\?}WCyިzWkEpC)҄!鴩NKC~ּfiaed`r TXzG>[5I"Qo} [o5$vCuJΛdF}syWuY-G~xN9(sGU%H߃?ZFu\2Hڤr[JŔ-Ķ q)`kfԵGu>b˞}+)5Cr4NcN KSJsqgnCuWk䶌\(uY&ʠ>EJ)zZDu81CY5$ _xp}+6qO) Cr1'Wk\e9>}wϽRTRf>_I#C}M-o?O0ˋp|tox"0+Vb/6?LmwϹcVu˧#ڌğzcˑQoz+hS"nI<Yhco_ĝ@lբWڀڦ37.xVznSG>&1 v}lu %2^Gֹu[f fuREb#4"I/bD\d{X9Sh]22naѲx>ݿJuƌFCer@K}JaGNyos'ct%]) 70IYpP[޵˔$ݹe| i݅Ǵ .P?j! 0=VB ; prO4\9Ue5 *kA8f&'ȑVIrEFi7RwkI/2IT%MC2N8$Itmua]=oIqT|KS\'}F/Zx1QU*Fѳ ۱;4k6U '.Gsk1 z缙ŊȔQ[#qJaEuzφvF: |F(0ԕ[jQ>Z&N|{ Ao0AF9. ҸQ,eF$h[.Hd*qTs:R\MB9gSi#Fs Vycܚ_Yj:lSin ZFc9$=돎ceU JaB~HIZӴݤ,>bZVK\9TT{6Z,Xrqr5Q x)lK^yYlua4f@<47GoscCH}OP,1c8hm:dt?J~YVn.}@ONgF>TN=ɣ6C ݭD^C0-}ƍG.?u-گ7p>U'*lHn'/d#Ō>n:W=hjtЛ,$mVO.$\]c3}F}k?S:\znj͵d8yc9ҹ-OZs3a~nް5 'dfup>Luf)"ދa%%Xcƽ?Lmu Hٸ >SW2mŎbC$㩮[fY wԛ&9R=oe[U!}Qr$?v- Fi)@ii){P{4v,r& AFh)fڣjJOh;~tU c]R t~Q]Ɓm*jn~AVA@[U^fKOCVET?lS((\[wU)?ʼl>s$eOB1^kZ=áZLg>j U1;ԠP(*zSqW4 Pze&lT6lBj!qF>(4SM-%@oP!__𝶨:ꩦ+x'>R_U5 ԙgE{FEGF?P#_ ;k,laX@B@KIH\ " ) iiJqUtO֭j_tM_#^r%lNv-696N*n2ϖ•Mo7pw:a26kXOsqLWhKE ޟJ.dzQifbNyrN3]dF*;LiؤfP1N?5"uND@v^Z+tɛ p7s\~ahi :F23Zy%)`v+}i f"K~ۻ K!C²qYL<Jj7)܋}M#(Ҟ8)܍:xf/P_-Isϭs7 D\Ƶxb$c'#Yqƻc\Ǩ>ծ=NuګsU =WoP#=(c}'ސyGL~5 l~ǡz.L+$/+= xⱳ@yYXTpk2[ᝉ=8RM#=rlu9;*2dP<4˜,`U4RUpI)&[-69޻8g9ԋwB\ѹ(V%rKTv%cUdΤ μ0bUݣaA~y{ [n7~pɃּd{pjexOc9*v3X3$` #޸Bɡ) q'l&-Mۦ})u9Ԙ2?_qW53e'ҳ5.n-r}OoW1qҬh VO/%A@M,ZlQ@;0%{ zk:n9KlFTrI'<֎bԬq۫u $z#P:MjCw6r%sHeȼC}*ˏλrۙel;ۺto:EвNXmGƺ 6zn"W`?uʺZO .Ye6MF ^q׆<sց뗗73M䬓4c83Z >;ud}NXQӊb~ysqq*ݴ뎘ncwukTlt}^0 [Λ5[4UTQN+&6cFg\_lo}Q?Z_,c |M$GPRYdnz(~m u⪈;A{SWXwG"-$܌e2AsֻSGsrtV(t?v?vZm; Lڀ!%ܨ$dQ@Lw4 WGJm֯Zm:-%-[Z5V]&RUBԸҘ(* m g@lOҮĵ(@%LFi( |<ٿJ ztX/:0+f ]~ j+ٿ zP{Ryj{RySh_Mܡ}T%=)^>) ƷIs9?^'jpv#>޹15!wCO0୼lӦU !n& aWbҭ Fy{7' x=Mt,JJ&42v^o&\3bFS>G-pbӺrT\gS3{݂Mr/K)c͹T <sT/%dX䑏rs+Oez e;wLs\jl|]VþOc/zf\t~$#gcޫH_jyB"9?dS3#ڥ>ՏإvT۔{:pxO_ޮ*Rlm 8ف:WOʻ;H%X >pȫ>bRZǟˇUHdh=)4)Ity>XJ8@8N^uk e%@ 4DsIkTuӬPǧzbF׷q{8P\)ێM>}k5 H~Js',:Wi+u')!c02p[ͥ,11X辌:~cʷ>~ѹǿR!vUH>^}2-69bx;[k7p]mw.RF+}u>#huP&N;⼆?2c 8+1ng= DbڼKn l nQG? `[+ȩu;wG;Ґ!'kHƐ2\nmhѵȶ1ۍ[5F]BX-^1Q.oyjxC~kɸ5J̎=z'I2$oǧMDVSfi9*b1* I[Z~DaHUߴ$)RkK\PaІzIRi0ƅW~jpySk)F&(4j:p(!S6imXR1)htөMVWJå:H)iv %V?JG}(rR (@-:R*՟MQJ2*p{!7: E~4jd EPH)iRJZQK@.()i)hE8SE-1t5U5aXhA*09P))E/Z(!q`7 ( S #Ji9-ҪWz*ĕ]RRh5)5GҐ 4@QYj5bpBktC0۩]+ɼGc+i`uR V{:3F%ĝk53JXy]zt $M i8ZSңc“`"sRI9AMJ @ 1 4i߁:m5?wa/nvCt}AZNsA׵tw3 aNB)FaF֊Jb"OQU7*A8UfPQ$Sv^ npߦ+^ዟxяv1?=CqWf&ECoާM҉?\c+Z|mok0N:Ke$Э`Xku=QkPzO5,VW\Jr{{WDiqSJ(X›G{{! S-@jen:oUIؤ2ZLsZe+@>p0SCOs?0k>q" 9?Zbe>^N+G=%\|2y]5[xPߘŖ^n#-ܐmSҵTMPZ;`@8Os~ދ7wq˫q%~y5R[+0wӒlyn19bG]EtIħW$g|E*GIhmO>:Ьp!Op?Z@i,:?K믰G[`J<[)<JOB ӑ]4█rrwe/\$ұ䪨Fswe%|^o6~csq2*mIURzf^yh{eK`JEPZRs#~kT,Lt-\rMRFes`u5.)Ҳ,cNT#q,}'ױ6YZo \CZxE?(m~F-чypA& k$=1+il3u)Ÿ6^9qvl$zŕz_ LFƠi8$qk-iz\ơOxB΁U#mn#~w$I0yy0Sfh\2K㹀J5^S x_w-!3hL!Riܠ  ?y9aWe#_ѿӕc-)LW)fL;UV]&Lr{zS? zL{SSYM}t]9=]u-I7&a|>V?"h`*YݺrO˭hrÃ鷟֩!2M9g8'r+^>Qתէ2C#"l4ii)r=jFE74v95j TIk\ݩTYU7M ^ҸYXjX|^nYS 5;N @4J*(fYrԢP\7ҧQM,ોT૫҄1QKLAE>IQ4J?րY֟k@PZJZCҘ IKF(ulvk%u@: чEȱEfR/VmWEƍuAG֜5kSx@4Iuq* ]Fzhzӄ(>ij( ր%Êv@ií*<չF qQRӪj њm4>L?JB4Pxiri:P[U~eW@5YU~) w̃hܪ9#iY~DcqX50,Qֲ>TtP(_mŽ+: Xr?P+뷸hNjGOڔfQSsM'Zi@ oOv^mٛf,K~2c>W^{6ѓDG2U&&[χn+V65vbɕ8Ǎ:+u un@ʣ'lwQKRPfWkm":Af$tsQVEu_^ך iVPWCۜc<םY!FPG*&GC})'kGJҷaG iLQƥq\XS/JuEb#LM~]Q:9~}bzv^뷒ǂ5 1i]+~TScOd[OVҥ/?W/O 7$p];3Lo^cyGzJ[Pdw-!cX[&=H90Av("3j ^Zf{R`W`e1v8G2[HI8 ɮ$VVp~^+?3U ̟}/5WQ_YJ)&2B{b?RGzh2?>ȧDHA M.Pk\0CҹO FҺsr`}kH[S7vqRi[aH֤[hăJ(gR=ߪVqW-WDv1{Z)M%2EQHh\W ڷzM`aY3H@Ll!XϵuXOXGYDq.sQVp |J;KAqP=8ݓnjӄ',@rviPش J{Ğ&:dqy(Qmۮ=:议!0׳bO=O@<~U t2n*?@Ƿ$~ٌHHŝfbrI=IBvijTܛZMSYg-¡!X>إ巈."Q\޳K#GMƅDȷixWL\}23ZƃV }y~5$ygnI>㊫|pux8.m9!DgiFQ P[(ٹ\/V7x32S'֡/KrvGw7h9QzUZvlrp* lTc?,e ?p^ݣ=QBWt#Q ,*$6 @ZG\>Z]MދdAHMcQY!XWj~U05[갶j|OkboҴR(R('Gj`QNxNkWD1zVNJnͮ!^ g yKV-ٕ?b&?194 YX}M)e<+oz_=h5)ZH?:zk3\}Ms{xty@决aM-[ -2$&+@ڣ3g {¯ lRS\/V5YCPsV܎Q z#r2ਨ w^%J) O7!AL0ap$uM:|BG^OooΚu C5θދLE{oEԟƲát}(oj=i?|=hX迵ڐ}+̝I踎QE3AqX #zo⋁nj6wVarԿk> ֛toҳ}jՔ1-\GVF?حf̭zU"kZFvqP;{ zࠬA9,̠:V;j %ʑTj؍t7c :^ki}l4aXv^3mHK[s ?S>`ݲ:5Fs}Q]Z=G^vFxc #?Y'usu$B82=3Nk#kŦ`a!?洞7^2 HȀjKj#rkCM}ɢk[u3ʤ u& D;÷_,8?U\5i#ADgGҪ%R@PL L;F\ q @}80Dk&;fPqП.8?)H5NցCh_s:Rw[0rsRTeIXsVY@>-LckEL0}9'ִt[сF 1LY pQE8RQKIK@ )N)?JXk#ajbY&Q2ޞުvɴ֤b29 buGZ8} und0{`!Ҹ2_1m (3F9BOY`iehT͠<LfÙjy'"oS\M(ˏ9>9o Mbxe?^" hқ):ZFAV#QiUsq5[~[uy߱yZ6͘xg#ʟ q?YWYvg#G7K ɸ'^㨫S"9a.w w9$`8LzO/<39c by|(ğŘ5[jp;Rb85<|mRXdSX5j;y"1yJ…,NHQZp|lq@3 hUޫdezW o?[ԭQ{:ңۋy>H]yߎ~Ѯ-0xO@+J=̗ws\s$]7\V$NgE#r~֏\,-!Qo\$vUS,AbHrq k7Z}rOUi6iFkPs 7t㩪m\WW9b=YrsUČ)YBc'(Ȅ $hb p:RbrrxS*6`SWw ,Ǣ4= yngRǫAEڲIFʇe/I59 YMs#  ҽCwj[هwnleNX0Pv95mLm3 9nDqz ^1!?7 vGWhMWdk9n &+<1ju'|NI2©ڰ2iݑ1IFiaX+тO>n.(4vd%C 5QFH vc}뒽{tA'k=N #Cy8Njl1qF{O?GOޗz"4{IVV'AR i̥r@hGkIdg37.ܒ?ӮD[;Ӟk<.>D`#Tƞ[wY:sq+D.vm*Gu']Y.nG8q@9 Cvyvam qלVfMz/_ǭZ2-+T #ۼ,ȣU$wن2Ojǘcb * Ij68^!w.΂L:;ƫG;B 8?OPXbl9>Fꑑi$$=J~u)mi~&ek@ _@XG[ۘ)vg0[ҥ@/>q#v1?ߨ[|ǨXҁ, 2( UkI;KmPvd'9\=fĘ<ՙf4 'Sf2.G )9QM׫s#cv'0-D7?Nt61* ʙ=OO ~m%-sJeskG77hQN )0RNbҝڎ)x })wZ(i8 \ b+\ewo\@ b7pzPn(=E9doJ~F0i֝OC@VxؓZf¢X \5nK袷2i ֞-c?-awJ݊CQun)B 珈&?vJo}&t@NT! ~n)*ZZBb_JL]''P ?J)kt("tŽ)߅0KIZCQ9i%BZǵ1 raNwPMBcR Rd(&b:o*;gudo:ieyygҀ(4_1J}( 6V#Q> jo,iCh=,u CjdPR1RM=SYN9mQ<ˊP:g rWK ;nltԊ;>c4bywб?v@O]mۑ`j1r ubNRy nv1jr<i,{XBױMxU4:f#85d:kJ WrՕuҍy09_R4s208"IzjB)NsI@>ӫ[D@+sЅq]=Ms^-5c쿭t?OBJnj< z`kLk?+ȸZY65#!#8"ӥPs\1ʌJm^!K$E2Ĭ9KȎxZsx+q隼1#$fk|Czmkt 8#cj_ܼ(Ѵ6StyZ-b99 Ú#]N,Q>s^Z/ݨ*pޕ["Cޣ Hqҹ1MHbp9xt85&fe!IA9?TV15␎ՠ{qQ"#SKG4r#ᱻ$z㎕^I{k5!FUR鎬@X6*;s+Ka| Φ͠ӂCAr0NGV5Sy0ךލ8Iّ9- = xՃHA\'R3 )b] zX~];L)'kY>fw < WdJ:hc)P7c6#PRI%UG֮)و r*szmxٲa ^7r_?Pq^謍iO ~K}P"yzɾ>o{0jt^)Z#ZtMH6뉗Nϡ>hзcA0S?vS_q^68$-J> )˕\p8Qb^îjK;'O+հΟ=6 {O+^hʟc\>dCj<؉Op{-'$LL+[I`1nùg꺵8֢rX~d(yJbx}s.a`WQ$Iz9$r(֠>zgڹkX^R^Vi&KSYe 8u]+^hq0ʁ G9ᛶ1iqr3`+'=5co (p6~,pp@?mQbSq#9^N"4eˢ–8ڹP(nUue#e֪Mj-`ljbN=@ nwݝ۷jmےs? oFg[F"A(MOH.Xda[YwBpGj%WpYzj ͛5F|kI=Ka >\J nyv3 @vd%E{wW f% 8*lQҥgU[FJ7VufV eno"l_&?>(sEcf;#Ҡx̻0*2d2[t)2$!I9$``ⳬ"\asZ +ʀ&*ϽL$63HgS>l*s:]6p7rfWZP s ;ViA5udoMw@ӳ^x 2vCLJ.F+_; ~_gc Mz=)\!۾+`R}@M+~)a@Sc~5kWɴcu$=k8TF9]%V cwG] 'mlbuZ ksLG9ŽS<6ٍm\[EdV1!B4M"լRqOj =Mf\ӭhG^J/fVW٭ѣfJe*][Gkn|qđ.b@:J(J(IZJ袊bQù(ަ\R`PyoSK?? f[t>F@ ?>J\SKs֒{і3H=O.}OFsR\2}hAKi(1RsPoΥe:EJ]ѽ:m{xtX'44GҖ}i2}M%>SI2)>'dzњ\SHI4sHA@ j7,!Oa4wLKHdѳrORd: ir}M6O>(rh(7('t@zdRpNI!1Rz1f)$JU|Q8s@ H4̃h#SdxBG>2|u7_S5,5Ŀ?FIW3#xt=(27L.ާmLg>9ד֡4sL aWk?L?M ~.~+YVEi03wA5p Pٙұ vp*TRw+K͌ɛz6kSyUrND}ѷձ\4&Pڒii 74I@6@ 4I@tQEP(((((((((=IQ?ZTz)pi@M ME((((hSJ(5@6H:)i)MG sQTdbpiRRTʘ㊘ SB(EPEPEPSJJu )i1@ E.( \R#dSCLS4PF64:ݨ>R&&u-4cҝ%PE&2q;zniZ(`@ E$j:C$Psځ 1BR u#PwiQE)P$8_W#&EޑC&90zHGT(S%Bh4\JCM^)N'ih;SM;4JxU''8Z5Rvn? (uǭF&ҁni0Tiq+dc#GPj_`FiiԆiڤ5:X֏zͺi ?ݭZhLkt_kCY7]֓Q Kb΁+k>J1m~<ڙ4@kxtDk޺JhE1 IE!4-4iJZm k)iҀ)JcRATzXUĿh*QEk#YFo";źJA 1MiV|; F=ç>k^D{Iqހ-펧}c o,% mu*0AU/hfb/5[K{䶺x@\Ŷi^WZԂk얈jZکƣ'OOzvǥvڔ1GJf)9'?(G"D/7xcVddp~^+>&>DfE|߇Vv{4bI=o#\2<X:e5h|Xh"\eUl?0&7:꺬Vy7b-.(##8Virij:+6mB.>; p%}Rm`SW@T5_L֗,Zޛ! =CD 2 x|A%=؊aoujhe 0g0_\PMVYO;Q+vÿi7໷Z˘>cpl1Lu}.^a}Wq& = )M=<xo#eTKJ~9⡗:[_[Yxg]{-a=8# !;q8xOujhAǘylk6{Vw7x'''4Mya\^CqKgj<ȆVqGxZN=*k[#zFX|v8ujZΫ9SKe9a(r6ԾЮƹ[Dv7pv=`zefoq!PhCy<) Ձgp:N*HS}wgz2;RR@ ~lcqsV^x;`g'<@?j0h:ϻnSv'ƴ4_MM{^Y|#x)#8˳`);)i+'Ŗs= UQy8VdoVMΛ=OH.?3 7 ӭt/c5yt:Lԣ\."qJ5c>S}VJAHryn۞ cxSHx5׿ĺ[%]`YUw0 A\e'V&!onUͻoh >(iPQ%:+nΟmǶs³|a>kXontg͔|=r#rsJͅ:ܷVzjMػPr`3M+z}揩R@' 2Gk8CN5/İX-/MbL" p>mPsZnƵOxFk9-'VBwr~0={ZLQ`wq$7s@PXqN*ŧ;+9dҵ;]?Sɱ.#Ug91rː3T6}y-|Ւ0s.Hz: YJ4#SIC9w{>EkXФ0,BPp &>#|{',M!"Xmsp\|۶zG躅ߎ<oM_ޣ8:i|T R:p6aW~)]6ݴۍVKGXn$ 䑌_O>tto9oZ###H8'` uZĺ捪_g9HG/3)T/E1J@bxWǂSd8,R$@G=zs[87oK=SnId*ݬ9펧Jɼ֯/o4.Sk9=jѴ_^%'m6o.;+du5/ׅeRKkNXXE"˼u `:|f-.CYG6"7* 1ֹk_cb^K"sJ [.m|4RDU>ȻOpu:We Wle} m Ι?T$[[yȡ!B1ާ皿^":k葼Wp$jFyyK OxDҚ]w6ս9 ?`_]ɢiWe81$YAFaHcK gn_e ۟fv1.z-5|zS۴׉ zq_/,ci5;Uے(C0Fs@:l`pAq^_y}0[hAcRs\zתv^h ie5dw۹>.Ŕqmch2hMY]:Y)rAgbQ=HD h4hPE" =qY>&j?ekK(8!(NGC}k۟ Ym[QCɂ3>YAY]K m-f DXƁ{ޫx-7AO!Yy_,;,@P߄Ư%Qα o5)`H Z58jiaZI!d1ЃAMiEo 隣9[[f.\|ĖӥbK]/Wӭo5w}k3 0 ⺍[0iCNE{ A3ͷV'Zo-:\\}'ޑ!@9 `MMSQ.u5MIMֆ'Eޠ sqa[hZ)Ah#G^Y<_[=.kMCS]9!ff ;X)?Lw᫨,4JqϽ`l3}\摩jz~s7z^y~pMc8nҐkO⋭bOmmHq$;l*i6:=Ģtۓݷ<3&r^ǚP ĆO<0G9b?p^o:>1t$?6tg@^5m4CT6j;ELEJK0$oqU|Oٯ)g6ڈiwTU$p3Ui:mC-H/,Rx$#$5hkj#XbY$),d+͆;Cw.kwڅd ã+aG^e*=.mVӵRoeD,x݌~zG-ݷ. Wke WUr5džtoq ~s;@U֥z-2HdzҲjm jjx HszCZ:RO_C 7$,i6$*[u#^Saqi]xIm[IpJs@91L f{j# {n1mTF9LFsֆu JHg, |J2pqm?Go-Ewsi}+$V%r\qiu?l`^ˮ<1ǽ ;Qj|4+u-ǵ@n`Xs)l.tV- UYvnܻpHN7nK_)ĪAo >Ӆ^yHszI@מ<[}{V?7Zӵ!],N:U[O}67ˤꉣ̶2F!#q7nllc ֆYxź-56oS {W/o-r?ZF8-Ώym?/<o˦iuol;A,,pHQqP~=,|=kCu}kmn 1i#=o4Ե4[bR#Uk7HfޡAy}{:Nc]?Y;0[C/~<m,Vn{2Mm[O"pYqr^Z>$R4ڢ:jyJ;oiļkh&޿Dvw <[jkMKi,L2ܬz<]hx?x^gϧM{h*bG=zsT-4/>?{-m\Ylg=zI9[Xs>c5<&W9IH uGouzVz.-v[RGV}_Kqiye{D,ř:kN6Ǩ[k( kH#CrFy}x]i> 4輫{dXr2 41_ƳojFҤ1-cvc ׯ|Zd4i\jI"ۛ}NNJwg<xxH7wCQ̌7 gԃV&^׾i.{ck{#@0X038 ;}#j֚f^DՃ ۹v$6y5 ηg:&\FZYv ̹F;Xp}+-w>6բi:Ƶ H»ƱFfzxoXokSrOG>ļ,@.xp2sP6uswͯ{gXY :;4IYpz;׮hKqipmь,TÁ<Z࿰CesujB, 1%~=+Ьd?i2@ T H☏3'ҾhMf>^5f'-dgzewUԏ漶ʂ5#naykb?p3mGH~m~_ֵ|Ak_J%W6klvKH;ao|3Oxmn5}DEPq]&+{FM48x ެz8>xB .95m+[[$/޽2yuY5m8]hH3pH3ϥ _^i]'S1_\ƫQŗp]dTw^8|Azi6ڪr9N:V{wѬ? 9{ }#q9$ )PqM헎Y\AP{3m&>`9;OiKTF3@A-;p]Y 2S ݴ'(wPpsWnSx.?iY.| 2Hob;V hz<,:zmok5Ʒ#Eod8ӭAm VDw0iwZG-#iU6{hbwm7QK寐v7|5cVӼA&m[-[PI:cr1\}4#^MRn $p/lLR>luZq-ŝ唂;KHʞ  \]rAGl "yn`IߑKOLf_ iͯ_Cm.[E"MAT$\n aRx-m:2 (Ig> |cy|i};KfQ{̭Бآc +2Z*b$$ヅW3/IЭt6f:*9$d*zvmsF^zJj6+HZ)b;CvGQM=J<$b!yfc:%W21 ظ 8Gji<%?,";GNH@S洌'үMhhapD&`Sr(}Kj2 wץ;R%E[gP.1so7@>”rq*Mz{iHrEj~LQ)@x9 !.CI!%B1d'зQV&E8HP Gڱν%E'dxuV'nszorZG2)+7Nǽ 9Qo;E*iJ͜!I8u;>L! 2H۩V- ϥK%mhDfV?4 ]xķ,ͩzc!#@j``鷰l3.WpAGX0 +Յ㑖yk9<= wޗ:T͏zr fKxK5kY>{YcU%9m[NҞS\ۅ ۸2I5voYj.eE4wBU2vHR 8W3?+-3 P7V^5I*䤀eqZrc$iږo$+&ec,TGc^d:hvPkhv*ѲN{Euo3Oɿ56ddF3ncj^saa<7-~GdzVMɌ&P@s[o༷m\F`87f5ŏ9+51:2dqSITM9U~~3P?a]#Akr;K[=)T_cUCUi? 鿷:am_θLQ֋@:-h?:GQƋA-B"+,ަ%M tjWl;ʸfϯjڋY8 p c袊B(((k607?lKH>Fmv3ޮ]7 ZuQ@OPl[ɼyp|`H^ yT4bWkձ6W-kq2q~`3r2*QEQHXӃERլou+:mV=6]9M]i:[zlu-7H=E]4  ^ԔsAԘ(J3LCOZ;QJ` )iQEQEQIE-PIFhèc>)QEQExGC w:h1+DJ 5cemXgeAm 4 XnҚ)ǥ4tQE0 ( ( ( CKHh(TJ6}jQRU. yy~` PqگRs@ E'4QE1Q@54(& Q1H˟`)9k o9<u{c΃AA|{VWn91sRzVk&i%V?'He)-zT^@3atgmj5qt7613?{jΠ1vJґHkwMizg1"=?:p?O?֣?ցp*LtALEB>qVyHRdPдQEQEP\5k]$z=ĖWq̮AG̤qJkŞIsl2Y 3ȮE[x>S ։y 0fxVSs"gυb}SVkWk5ʬI"A8mNYAw:rTt^(hčii- jumߠ_ Cem]զ%&h4tg6i; ̹]Lo.4{6RɦFyQ)R 9<ДxO}}=l|$gݜcQFj5ya]+Fl\uW5 OK-'0>B] =EVB{۰לzzoWOV ,S?) 9ϥp~WĚEm[D=;AZ֣Ŭ̂?FlźB1Yr王S\q3`M"Lqe=H6V  ێ_ŷJW[FChiTn w( Ӳ~%X Vhs79 ,;h4Ƹ|M}*e8TrF]>w[IUFhB8 PrQ@0.Q7k59'z8<<>1öz1k$MpcE$ $0Nsڿ{E_ɴIn*>M˕''UI|ǣzUΝs67wFpD $d^.Ԯ#kI[]G-n&S21A)cǒT^Ե=bY Yb0 [s=,~:_Ϩ$R]L6gȊUvj[ ֝CvW ^|)0y;ޘ}/!ǚAaoa^\MT1Vf?* ׼y{3ky#{n5b bYۣzZi~%\Ǔ\n< kqkhpQw)6Q0#H M+:߃Zt^iKk}bfF1>e`F1yOa,W( sdG|񎕪kwE%Ѡ^="(Tu۞9Iee I r@G|Wukp^+IoftEƒ֯A)nۃ3j:>KQd5cܯ v;kY׈ui,͔o P{i-As>:-FBCasĬbKupW'ڀZȺVkjn*i1r1⫓1 C6GK=ݾhbr{W^daҚ8]B萤Usm)p9$,PfA;ZKiROk:l=>z As{)a/uۻCci=r?`4;κmf: DH; I]qM4sI%簧q@ ny >EUVH<8??Jwчo~1Q˼AlڨyZUT= U}S񞢣ḑ %Tց*t]@ M4Jm'z^Ԕ(1PRR!q'ZڱճڱP#J-\SRu XUn ʩZ&pz5ƺs%O<YhpOQ3zJ; ϳ|#Gm ?ݍ$Tx8( u`"I?#C 4"?U7xT 0 2{ .dHcYUY%8\ d'ր9o htmBH쮵mۈyݐ7+cG\n=s_Q^zX[7UפYhzFs%͆ci<KonHiKi 1B"] Ucr!SAѯ-TfcYX"yn1NF8xm/.4/h i3FF¶i!{{ R7W.upWi{Tw#2A8ﴝ7T[mCOBbdE#@`EpZx_͆=Vm!_2 a1T9'k,,dxL}+NL̓O}?h_*b9f1TlŚ-D~P ۷1(o-tmnCoqx7u"8bqzbFw+[KF*Fm}t4Ӵm>fZK{T=FTOC.5gҬe/n*}hI|A_[yoMI,R/aXBރ&xZfuuvm؝n xޅcaȯHKh#i!e@ «\hUޝsYcQ+FF ^[Eo-!eK(T,_h,2H`uGkb=J!hVIw%<<˺_1$IRkmChVV썔J`pF:[@.Ђ?2=qN=y\]t95mtH5B Fլ)AhS])c^ u+[]:,\t\!ܩ&QdqHu8 $- I#z߽Xu 7 LJ%>l%$$1 gi0YXH.a,#([޺t }8XEbTHTGc'"@ )iQEQEJ(vtQHpCh@QEQEғ8:S# b ( ( (E (R'zm p%ZQ 4Šb ( (i -4SiwNTjUhh^v+W)[ծB)Y6UJcJ1fsM&3}M23sP3X=+7Jp>jǤ\V4v0즗VU/Zԡk7TpIJb7 Q9>n <3 S3( (()A"@RQEQEQEQEQEQEQEQEQEQEQEQEQEQE!өLiQERZC@5ԆPEPEPES(Җ(pH)QEQ@ ihsSh@QE0 ( (Qފ)ZZNQE('zZNC֚yL4 #ASIH S5%1)ИR 4)(iiI 4NE!HzR KGlPSiԔQJP1r]ާr'$? h GQ_92O*-{I4s( '!7\G0X"Zx]/ k𶭪NjW|9hR^{r: @l%4#讯rS} O\y5@\8$4\Š,u;s!4\,u4W)57eSn}xGhuI#~@[k#j'G0};jx_ dO񦯈ACZI4rMnĺKK'ی oQK?ƅ$ 3=nlju1O$hs?EꨮP]~u?3E) q]݀qu85u _4\,zU8t+TZPwvKsLhvWܒ>ż?kJG.:CXk5]]uvB?Ƃ3޼=B5 䳸De' I7zA\sJV.7Y˜"#BcsqCn`uOaoؑ[S+g>CZxYcƷOok{pΤOkoK]诞? sη\@AC?'G%=}E||E?'m=toQv>q^#[H?Ɨ=wԇ4}N]ۣJͼGb5O?rDe>'!S$&ǵ^O*˸{d}3E| 7uO _:T.`_2>IRڦ{I4+˱'zm?2Om??2O*R/nK_5MwT$r^݃j'Gԥ^v>?#q!O?'GO$>.c J=xqdK Hz4}J]:^ek.:qƶU|EÏX:-;#ըkvW&ISm|QO$;usd׆ޯ"rַ̥U'c֘5 [P_.\#P>6t5ir*|('McP*n?ݿƔ?#wk_bv=ZOy\z|y5sk ͷT.\Zqv5W=>ԙ[ָ>/4îkO56,J5X5K?P5x5 ҝMegQqOWFgZv=ӽ 1!k̟L:A}@ƀ=mҼ1g @95 ,{~)9^ꈍj [tt'ַV3!K?ƅQ}sS]V$t^zVU濫Gq_/5VۘhMO *p+5lX=̺Ơ|J^WCkԯoA\Ө;)g 1':I֚ڮrt}1;GEU=5u4\%yIյHмvѵ/ʄ\y~*shaZ"4=۟LmB?skKn5}|7{{4\q&Kۿ7p;]֔\@/.O 4+] )| ;LA6G`Oְu ۩i#F^ 3Hgi7ZJ.n3_\v_Uy1 'k'YEgs1&c9X;0z71wƐur5K}y?wƪ=LsB~A^],NF-ׯZ)xPTT>doΨ_(^$΀-09e{|ƨ,lH/Ri2^GQD ^?JHc'֕|]Jbp8i{}jwܹvdJTnnNM!>n* p3Pb<.w'|8뚻YHqj@xMS*AHi S(ӂ|^r1k3*rkoY# FM4&&sǀ~*trjN#i4i1ux#gP"ӬV 5i~7`1<{j9jMRҥ/p@\M1 $$FG 3UO3 M!ǵRoWPeϕr2xc]2r]Vq۩' j27ǜn@ K7q\R}_שȮoV 8V'9W qzU}YJW=`qQz܅c8j{7$b䝚'.'>¸%X^<JTfF\mgcy2q Nv9U/ ݋ߜfk.Mt (N.*T:?NeY;ZEZǺe+pג ݶw%VֱrR$g+q$@Jnmr}kKۈڻ2rԌ)qE8 1F)إ0Tf]PxvBnʚ!6 dʺkyY;U r5kd}lzp2*^%4/0^AiG.1x/Qzݹ7 ԫ!Zp *YYJ~UX瑞)ħ"}ι1`qĐtw9ir6OC'(6(zӹi88wjo ҩ 60y X+$\w=Nz {ռZghֱ;G?^d#׋'rZqJ6?&8T;^Ej,=!E'"vNE?G]cгC!1B+LN-X;w3v8tV rI!~qJns< c[a1mM#C6Q-ϥNWqw*#b=j<֗$QqKf}f GPi?>dMe9ӽj49S"t9= J:m yr^c0<{WV"х=8Kpň7LWN܂:.V85Z׺:)^em EA5kJKΤ_1Hk E`&4Y7&w\5{Ekŭ=jr05X*1C?qֱ]Z+ \ kG[#sTΚ_{jǸi62qZin9@hA"ЊN$)l`V?m0"FOL^ß#÷~iv&b4s1'%SjYR%NHC %[gEn?I8ne9ڒ$մ`>!>XOS f\z޲Qppu'?L֛Zy*-':}UlO\sOzSӊrW ԤR!lh׉H?p`}+:'# 8-$0\zwkb8n  =EL.Y{ {T]a~[h-Oz[lZy0S6= ʪzIs|K ̇q]$pF'+ EW֝/XY֗OZ*}iU PO'W3AYMv;e3I Lq&;GzH Q*05m ҷ|5Nsށa3t1Yju8Ug ig^e p.^ͧmP} NVO \jdtU^E2 ǥ  X'=iw+SQyx0: Ԫ"[4!cH2 }iXy֜x.xWs{%p=SE*$nzhY=+sÎdm3\ tWwQHdh؂ 8}fiPc7ɆUhsG>֮|?~6? @c/)xƂr]zQa_j(ZGIКG1+oiKr`Q`""LF"PN#b2m*~VB -gVksU4r+8n՟2$V ;SV~3@̾k`tځū*QlSRW=遁Ug?`t:HGiyjlК'Jޏ @ְ98' [,E;534Z.g;w 2:S<0j ֏GKG]2Y XNM9>cI}Kw"^w~J_Xſ+C-N]NԬňR=ng¼Y*6 s*si]DqL䠻g9M1DZ)@E^Cy84Ӳgm*j&5xTsmvIzw?6ᱰ5`%Eٜ8ګm=TWEjHfIQL4P)#w)wS<]+.2u-ŻW]%Μd4z+/-IWlHgxy6ZqWe? 9⡚TQ0^-絸j qzq.G%GAMbOMfC8%[fj+3m@i=Q8f-g+#zRz)͈©#Ps𫀌{r*PWX<kG?;jE9=JH.@blޞԻ&jw#.shw8*; 0?9W pk>O2!S'zz*;D 6@M;ȫJMݎx;)n;<★(H#kx}u{]N@>²w+gD` j6iOGv"**d▔ a*\SHhE!zPGf:VcHjhRO<6)jiot#5WOׯRSI4P犕O#CAHKHN*qd+9[<U Q9{*+ޱ(8wUk[׆rVvc‚?n6#9_G!c}T%nI %v^?A׽V^$Q{ӽ ץ aҍT,fX9?z[u\Mᙓ9MIrW5ҹ=3T5-QRq٫=r+U%a4s::QZ4 0Tw-҄l7vU|T>Z/sޮ]@LPl _Vw-i2&h/SJoJGW~qAXõaWIRG+ #o9R ?4+3AAWր(\e5dm~CSjL.w޹9^Ԇt㯭J:sU!%f\ax=* !1ǥ2HޥI8P2َ2Xe=@t&,5>b ؕWM-(N3@4 ޣRd;_s~犻zX~PUJmS˫w=%dVȵs|"aCcsϛ! C&F-ጢc ά,1 U*lb"'y1VEU▴QHG7rEU/ȧ?bPx^ΏΩb9BӅ>Bߝ*տ:ΥGsL_V9ɬ4rC|OVh4M ꎋ򪺆w5^=J.[-isڄ Λ;5Z|WF;u0jOC5LG++Ik u"z2O86\Zӡ?EhrSZ⠼>s;uȦlɩ /Q`mNҳ 8玿L bC֜辴@ zJ~Z~Ehr~.7pG^+KàŧDL sKcb,0 ?ޕh\W==O5?QcTaj5 ;sHc vhQ$fAIHM3@H"-#QNvS)E>)s15u()A5[6{։U Hl cVQcֺ=:2g\COC${ ܧJY bbHfl?ʴc9bؤ݃֝ިI`/FO ]n`n;"]bH Wv:p9rFV*?9:sSVR-(Mf+>KP<3Ufg)ԀajWBj"e /kR0j͵Ƕl @W7VE$W#Hl@Yߩ^ίjF#֠^scE{z2*4稢rwGV? "EQ'Μ>ԋb2((I!+c+XG!9@~x#|_B] 4GGcosΟG4_gB{4U]D/eᏊ>??ƃ'׾O 1>|*'+a?P*N NJ*QG˳wu?^3hTq>W4TS8;- U>B#|.Q'V]G*Cw*ό_@QKuD|.X=i@~SO 1<"ᧉpXCs~uĶlN{%[S[[qr@ &:먛Z?z>Ays/Z 2g 2*'?ƽ~BQ< >x+5l Z3xѧq=kکk EI8r-Ӿx,Q[on gרQ[*J,Z+j Uo$$'_^EDʊVG%l¿.khU?|Fz:to+(k(.xT" 3f5S7<|x='| O^E.T>fy'G'O??ƽz9Ps3'OOϚ (1~!44~!454QǏOK'??zr1?x}'/??zrD< ON?zX9Ɯ<Ϫz(s3GuOQ\_"h??ƽn, ~??oHN#vϜG Mc⩿c1U}X.|mG5?uK[WU@khi7BѯjĿخ,g|='^G7KZhs>Զ.I;b"^8֊,8Dp1'#)vQ`;`9l4gwS]X.qú_=>qR`jخʊ,gyRN Ԍf4_4 \ P{?ͿOR1y.N /”z/i6˞vKyr|?zt?5*-3o_kʖ܎EHixhwkT`uf > stream xY;,7 ;l@sxHITS70XLUb$Ϗ~9kM_?j}1$d4|ccߘ׿~hbJԖi ' 86[\Lql$R2t9WM~? j| 3GsS4U"JXH5ARzap0^="ԛ;ZЊZlj3QAc > R*~u!#MdòBi$TeIInM5ETNųYEeϕyž$j69e@ DJ@vt}{`jچPQ8E/Շ?;A a^ 1;S*miDK&U?MqkU.sAGu5^31Zf^8{RD*W,şh57Z5 NoAz p5C(?A#nb@+=LH+6m,GZ% X"$A ?jwIO/qd`YRAh[d"v\+Awű qײ Ѫgg 1^xObmzg+:&Pᆘ's(wC\.dx<7N'u|o:~2qIyU4x($>SIhrXuᑽvCT+4 v. YI\?΀)魺EX pas+YOb> >=qzt#:o+eF3_] 07@t;C#.À^+qiM#!¨O^O1:reʈ';=Sz"^#6lYy¡6&*ވ$T/@$39+/[ogNƤ);IE_.XC@LP!U=P*Y,e)^W8~ IʐѪS>t$T !k~> endobj 21 0 obj <> endobj 22 0 obj <> stream x\K$;nP{ȱBiy @{O*"o:«:'!)tS't%=x/;qy:࿵֏-y.~йDW=ZqVzyw"qlR(P9Ң ڳ'4q <}¨:Rw<"N{BG*z$0QD$x ڥ[Ε NVP,*%Ұ3=QP! 8g.JF9hsCpFڵ3idFO VsO~U0 !Ϊ\,䝰Vkt$֬=ZwA+E`L։0B$XkfrԜc4 U_.߉~o:٣,:V0`w:[%.(gUcer  7eXzz!8^)Q`;?d2 "I+{^4$l2bM 4c %ϙ/'Q v.t2흰. 6lw._2jR_MTd'\7r'q_t\ XɓstWˠLJ`giHB ?#0YO]l$D FOG/@Bbɺ|4%LE"GBL~! AlY]UC&|J Ƕ  D Es> CG&cxPtӽ >N=Re]$IoM-stQVh@y\I)R=(PW!BRmD%Lg;ב۝rn^ 8 Hcti9aϦpq7UFbe5 JH qYo΀=|_(h *TZBrmi[@$ Җ@ MnSz8sDb4GSB5w8iUT)C q=,9)2%B+Q!S jQOz!䍝@gdp"hƼĴT(.H]ByҴ ,vD=)}jC4N,Z1`HU jDAh30Gd\Wcc\#i|y>#j<3;WbT0sgiL-a31 VxUF5btV8/#@G$ IӉg! 1>#ue^xfmfaBG`fu+3% qKWE<2! Fg˺ / Ӥ1IVc{ɝB ޜaWI m Py#âA1@Qe5NPiPX>"n!B2ܕD aT! FC*JFHLcP{"YI~~GunH\8F6lpD2End",5dVaktq<(Mq%Y*m>LVtz4iґ- -Z,RU[ eNk5$kJH"<1{a,#1Eө}DԵq}]cEty )2ve{Ќ.v&oj1Rڂk 6n7[͞a$A߄ײxbC}\EF ÉX_0RǻT{6Xbm 0C.XxFj17S} ' wT;=(_J{d}k}Ҥs Frx1xV?>6e އ6˶MpdbM@ 2(lI{\%|$G! ዐЖ >fc:dd=6Ǧ8. 뛤>mĭ˅@7S x!Z %br'-,\$Abn 9ex1#$X9%Y28?Q[%<˂~b} ,IdƇh*o݈)[T-Gw`P4Ѹ]vbT<"p,Ļ' 3EcDG]sd}_ 1N]%@Ū!" V!WpHЈZlFc4w7yU:0aYxSm>+d^N%˻bI ?a^V NXy~h#D@~WlDnFD7,+ٷIAU++'1X^NEW ,=+}%PD.7»|K&/#MlDB?OD=Q?}bIF0<OYB>>zY'&طrbb]԰߆ȷSsvks.^z*ꆿ z[$EZ,ϱHRc=2+ln yGS[CtPi;FM(yrE0LGTSs6xR-X =Bt%O\rO/ ӧe+# =–bҀc aAn]{~5#r(1cy'ˋ^CKPC !~=%{GAw~w!kJ.cm•T%1Cִ`4.rF5t]~y23{ nොd-sFJBf]0m=nd^C䗩c"1BHᮺyexb,9V}}7풉?ujĒD]Mh"J4Q[-3 ėܕR%RS cQPД IVX$M.M`3*cR׺I6kX (̄Dԍv^^  -wS_S"Ngл~"M& _ϊ0"+SDžn+!3./PV&eE2_\!=GȪAB7~/]6b,{??z<"ȯ*]%'m> endobj 24 0 obj [ 25 0 R] endobj 25 0 obj <> endobj 26 0 obj <> endobj 27 0 obj <> endobj 28 0 obj <> endobj 29 0 obj <> endobj 30 0 obj <> endobj 31 0 obj <> endobj 32 0 obj <> endobj 39 0 obj <> stream xWMo8czo ( II#b C[,P\Щ#Qfސ#)839P %0ʁ'WxA #D M0P1pPxt.@I.iA` RDdh5 JO3dB_QLxJ+LD3 h+U/I#o%"qI`dQʰ1֡ b!%*4q$&G T!yF5q18R S1n<"qF(&g/ Hx6[I4O[Mzh n>C yP6ýanW'/Nxq]@"8H֋'qO8..XXI~(:3@̯0Ư0/0+CͼU>Ϸ9#ik{ykpy pD<j_hT4g)vb/L}4iwU4Mtl]Uf&M4MM/WLiQ=7y2sS)hgGóKo0Q˙8_o7M^]ԫQI{!^U!^Q!^M!^I!^E!xZB}ƫ @xIHzt=@=Z:rD(EQϾmRT*XWa J%S|Dc}hr۫٨\ym/vLJT6+-}VrϮ˹iKޘҳMsYݻG7xt 7!}ZC%ro^PF,~Y_M6__nC:E/87]a_{gZs_UMt_S_&1e~qxzUߘ' ]ٿrY4G-M-.4ufځQ&2hyU=FbANnmLS5_YQ&E4G.lֻfc0귵~Іz1tDpA_ 3JA endstream endobj 88 0 obj [ 226 326 0 0 0 0 0 0 0 0 0 0 0 0 267 430 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 561 0 0 488 0 637 631 267 331 0 423 0 659 676 532 0 563 473 495 0 0 906 0 0 478 0 0 0 0 0 0 494 537 418 0 503 0 474 537 246 0 480 246 813 537 538 537 0 355 399 0 537 0 745] endobj 89 0 obj <> stream x |SU}/I=閴ii%mҍBЍRiY[ʪ"(#TQ4 AEEgQqu\qq#:m羓u}=/3 /2hlb՜] qʖ5 0hWOEfReUO!Fo5nc7<&ޞ/YAh Pfo գ;kj{Ҏ20_|sJvT-)]qn_cEEgY(_z7/[X,/^ ڲ0x~{@ٲ /#woi5R[vו,K}XvNo6onDZbea 2w.(>o[c>H.%$F{>yΗ6}`H3h(`9 ۯzc)H5 fgA;%b 4 ⷒlsXe*Q|  } d ;B]f lJ}Upـm*'ba/O `?DNs~A <h +?YS eUF 4?C?V#+m=A&2:Plh[wJ: &'9;H} g^= Fq1\8oِNW5?^?0FH ןTk. #a$0FH #a$0FH #a$01,-Ƅ@6)04B9Tdh3`,.XݰBRZ,&h:`ˇXKnz1j)tPgki! X„a#&U<2 {s+:90 L ,6fgebk/UP#RM?Wrz>ɾ|yH0Jdx`؈$٬NX1.9l#0ʓ?? sϬj_9g͜oinjl6~JښIU}eƏ2ft('7'LwYqF^V)r(0ȩrT娩iG*:)6TUjKfS-}h4KY,6تJhlJG-/른%%۱ʼ`@=UX_ZUX́^j2],s"BfUiZl@tVu44VUZ6IR]EE J˶빪ݚZbzz.݁,Ge f@*v`euMC ipz켣ȩF4| <ʇ8&̏=/W`&[)my sErs1gǂGe%5Ĉ#<֪  p*cDŽ^&(4cAy@(2/#pa{RO)\P`aE^/jiqBPq;'$.XV^6Yن6R!X2\ZTKerB878Ro yKڤl@ꔻxC޶Gto⭠r^ΡľAs+i,IQy:mmt6RTe!e,Lj*`j%Ψ6꼔hr; TSf51|PO(>r ]tq 9p ,qaC[LwnNZ~wWv^'|LM _Ss_$|AyS3 G F#1#‡%O8LU"ޣ_Sb)w)^ۄo )gkW D8H#e/^$@8@x%TH(a7aaNBL.@ۃɅ l#LGGCpN۩m-[ ~MULo&HDp=p-WkW~IUoW$~A \Np) -E . p>a #p)o~' >$|@5@O8L#%0.P0N06-›*j?^_%B*;H#eT%‹rG-u7gg Tij)T> wS}T#T.ÄBK Q l#O/.7?q`|=`Tĝi;Mۃ>mdLɭdr ,oMdp#D!߀_GH+,&2߈@W$ZƵ!B\,7qi0n&9Y^L&#ꫬj4SO<  J/Je;C(< ~PEnPDvPlAUzfQ6܀r=u(QE5֫Q~*Jp pl]0ߎcZIX4򥵜p.pa)lY3 cRB a a40PD($|1#@tm'ij$DZ> LPQ|1G8ʛ(ogP^Ey1({PE(}l=y/5 ݄ B9a"G(#L !EQ>띏Dُ"@}fzHh L#L% $B5PIH#ة6JH!$,$B"L4|7#PNG9 N?PF K/P>Y (}(](ϣ<{ߡ7(Ϣ<i>Gpw<e|Z%A#b"rB|B'aNKCMEIAh# -/C%܄lB!Ap47AND@`tGvdeCt+(B9GQʋ(/w\*:ϙzqzEլ_m_vںz־VqAm;/;?|AfmL}n1{~"ž>_L뻯0_nj{ZWfŶ~/C˙5,o_.Վzj5]ۖ-[lݲ-˞X&_ev eJm95K,eWe e{A`0 g#xo[__m3i6?3?s ?Z͞FӶF4TT{S'{jj 5l_%[ ו>hLݞҕ"tJ9"v%MY>i]I/]W'nIܞ(KQ>F27 yF%! [jv8M?W>m׳'t/ie:QiyZ7ɫyeiZj-i=>mzFuffFܢa>+SUH%T2BJ"1̀qnvxk_Ɂk]j D7 +f~5(^~˄@XJ_aR[֭)mux_Fx̲_ ˗V 0>/a2\'5P}/(`P{ e<*irJupS%Q娇r|GRİXYྙRYڰġ8X:sCehafjy1ϊ(6&.ż<l8&Px]o S((z -{Anm=2:7qL `cA4_LZ,eQFcmYUB ֳx9S=ooxX?؟njv$q:!*JpyQ‚ ¨"#M'H‚TAh&<7NL҅5rvѢ5U,řIrYBGGe;'2g$dUȔdSrݱe NHWѪ2uZV:UvM$I29.XY1.0Su7X'yqbI#??*/NMIW6Xd"rjsYR}ߍ/ao?1h絡e{kЎs*"pDĞʊ]MמkgU:wS=*ss^K7T&TΨF[%U]gLȌȑ-l\YdPL;1!+a0` |;)/iSn5'P }pO@ If-+QeIs48{FdF숫~LwkVt!>.F:o|= dV-mu΍g=9g8fcU-uh|gQE#JNTgO\}ςe-/c9.Z`HMJSM[zBnCdq#7tGLS*L@D:4eSS))]rL >Є>^cQIi谲2t9ݒ`o)r]eP4 ǣ.Ӧ2 SɚԂ WaVZ(Hհڔ WA6]eP)x_Fg#A'{#'ѫ*=S̋ŷ#8Ñ뵑Y xNvd^CG mۙs4)Gb͒B*_/Fٝ\ɊȃLz uUا:6?](JiNʹX,:mJU`ղŭ::VgJKJZZV/Q-8$%^WR/u/^9l/c|58uZ|Skl熧\6Μe)㟪hf>?Lyy&W1;5FDڼ48)ly iveU> S c#b.aJV'Mc1ZckSZc?`Z-|)Jw񒓻H\re8TTde}3QL|<$dj'IR*J=t0Q${'%=9#hSt Ol͛޽yw7կo︸nSn?9Soz{VO=gw^Yw(JN,X>+)“>%R/}̽C8"',{/Q#Hs  { )|؁Vg Li^%g?>kU8Yt+ vEWyQ sͫlV֦G^#/JF1fnfߍy 3(I}hl(CP ?ZHG{LbdJH`E +҂le|f/)8|VXnv3.073v^5`iy\aƴINSUx5̞?0i0vȟr2dxgLezB.8#W ʒ_wGxlvB-<& N/H/X[h<| *8%d\i&ZY :J_ M6 /;i{o(;_4tPğzUWMΊc2|!6,͛2*9~yyU[<&EIAΫ5s{_<jdMiIkvڞi7eOpW60ۣ3L$M,JqS &tLWvw4(vbӗ2&,`B/"vG)L2(mp^T5Hv{JVxb$ff'Չ|ոCǢ4օJJ4\iLfФ b|fJ|cY4T' P'T F>71S(bE[dF˦y&f1r(k6 4QfM44Y tsSy&ۧ>M Mbgϝ- g?\poykT<>I猰F&hoK8wvnq3&7~Ӎ:FB\=g%׷|>IeSvLˈK6[1!Az&CѼgNT^Wy)ʚΞ陃Ǎyũ:FWƱ#*ꐞ*Zdc}C7%g6Ҋ3_TаwǢ]|FE8dx\X :03+X!`d٣q5լ>?G~MOYy!vK] =m՚hP ;SUAUE+}lQ==;eWJP8UTS0oqRa}aQVfɞdݹOgH,tm9VUeK%p}[jKar*^.ɰtّłjOi%򼤕R&Эu 7~phщ.*sV-3Q]i m[w85NJ;'c* mi9 WT'_vDz"km&i1g6FgrMF EL436֞C.qŜou&-A&Li˄ _撽}Y$φ6î@g FQ4kXҌo|ɑE>[x}9G>oҶp؇SWQ,S++QU{3Gf$!!B@AO2yI2L&/HHbVV[?RJ[`PĨ`z1Ґ}L&!(ek>gw{0WNnʢޤ~cʌ%6YԼ,cW'7Nω˘<=#1}F Jƕޜ4~-sc撜0,';rNINLq}չ o?#7"bَ%[WeR133ܩɓٮzDZZ(lؗ_({B}aVQ ?'Zˣv&7L4%4~iu>ᄁ'$+M\x_sk_&2lpeClKH|aHF \7lb[F"_r9V[cY4+h(4qNb ' ee /:(fah8`cfWʾc]kٔ2)&')9g14qZRaIN 'e8{zJgY$-%=Ь;b?4"#?) e| uxfXH}Hm%B&2"GM* hl!噤O``NJ`s8n9HkxȟD7]+Z$[k\Ǔh*{yseoC[y+O`Sρoyy5~yv񞕶]~7+??m"itFqk^2oN= QiqFJɒirhڍQSil6yoe }c8S礅-޾ys ;{cQjyOBʼI bHgl͢mtlPQlًl1eAVfˏ)~ݭA;Ζ2b$ŘcFJK&eG:m+'"-Vo0T|*\DȧCϛϛo*:ʦf`91Q A-4}5?(>[SN`OGeX?_CɭN g<"[rM*Io(\5=aZJXҜI]u*QԚt%9 vkreK i"KD-+sbMaI,\;pӢt8bEB1񙅷aZ)[Blߤ1E>b  -㳊R"OG@!S|Vw)3t7ih_o83gH]Z-a]XhD<"Ř338''ZB*q,k~!\(ZPd1Zn_sx{aK̲IEO322?ϸoܑ\o4Zn1e(? 3ϽI 5~Δ)VeR9W~I1Fׂh=(gH< >aj3&U|S&T +M&PJʕJo*@5X2H;v`T'MXl]H=sLYCx2 47-5ujYm6n6gM7g1Zi3k-MKXg&Z,3ٮ]+}#Ӌ7$reU+ w+f}\*Y\~=:,Fu",gdܓʮ];N̈O:AV1YU+fAFj~`SYX)n&hFy!M=!fͰ3Sf~Xd~` aHӄL=saХK`nΛ"> 6o= Q"Z8*3 ISǨLAԯ~v4A2ҖȤQJc0lƟ]M2| ~ܷCdW0NT'0:>:;Fc4FAt[#[?hhhhhhhhhhh$P<c-CBIt+}!] 1$R"\tHH  yhVJCsyP!)v +H_쁜E!KӐҝ^AR%%d*xJpLzH_dt] .AWH;sz O!c KI(dt.Orm.?iN@FK!c ۥ.]A>2|tGzN@Z!-h}' d;˃Dw.^ ~i>D!cAe_!Y݃ޓ"E!1R {>!A J/c")V.c,NL%$o]ʿ)Y¯XZ :15[T)i\%AXIkIXu$Z崞%me$~%m"%J,V(ZmSҔh{@TPoݠV^H۔x%%YJZGl)i=k2 }6gJL+2ݨbp+vӲlg9-YNvӲlg9-YNvӲlg9-YNvӲl;%9d b$CINnDC\:pljTF<rHj^M(y#P(ZepՀ{ua{s8xJ٣xi'uVƩ4hA((mr;MqkQuw4f P" i(Ss^= j퓑n^vCC+2+VsK0`n}=xG\EU'ok9 sdh4*<]6rV糙-kn:d]U\3,_FyCyP]m4)Jrb}GfYDyk'+yq͞vv )JN7rk5+yL` a%]||МѰ9 |ܤܜ)식jz:\.ro}yUC2FYqڝ vSgop5ؑזּW;jV{[coh,ƺJg{=zjQ^Q恵4dۋ*S`T9\vmT4dj@Pp#ͪ6N7T5VyP4ݞzfoYvTx:Pr֡j{s#W,7jsSU]fJQjhDe_l8FEG͚ƍ܂ztuaovxj嶘+jdL?ߦ}~r5LاeϘbqTV:ATB'T-R x(> />X,L ׍Օxgj&O}xפjFo.ޥ[ x?_}x޿v&]B:}^7m{'n{_5[5 w?Z*{.:xm1}xQ=P`B mixWx= c ^`qT!:mw7uԸׯXWWw҉D*_>JFNOt|L Y:uXDzzzV?9|}-,G3#t3v}n ^DPFM4Ȗ~zXѨ ߏdEPw-hIiqZz+b9 J;6.^2^[i/ִrֈD+z9t U]]Nŋ mDV^X)T~'t<4hk9n(2L>l1*\ѯS!:"0 ~>Dt2'h/$01  ^CZ?hydjcm{k6êwe=-gQ&ހEi /P~emV[ٌR T/yF%:tuԌٕv'^GCz-s;i\*?z5ׯ7R/{\h1W~ÿxo9įWu~w!r-<ם#w}ч22ٹqՓs5HVCږl j_Z]>kn6judim=0\ÕtjPrts_Z՚=[Rt[햛gVѪV pUF5|wtNd#/*YC OlM Zj`Eb`CAYߛo_1$&Gt֠"-_Pe^w^efΛ9lB`<%#C<;*agVffuu. vtĠHe{[["s"srڐc|M5;OgӽRy>qeup/49]~7[^Y}VADқeloe+IL5k9;@MF=)(47LkҦ_Y!s##2_/gB gRS?L+X5c!sx~d瑝lu3[);]]UvPރ^Ga IL:j_9t&=L0H$ S ^hátĤrH0e 1n0MzV;'8I/anmpfR G\8?x/ymp\[;fmIhJlɴ uJ"m$}C8 H}#N>vYacӛ2ҹr8,ܖobW.1lpycɊ o눴5ٸ{Ȳ2 :aIfEq0ri!SBENBD0ʞ+Y'?Tv>z5U{_k~`iئ#~ SAY| s3zw|:?!s7L#)mcʫz>>#M JKNp|w2hNJGA'9B_(4TH2 y,duBS.F`d> e9#(a5ۻ^NѸpSxB= =DszeTSe?EEF&GRNԩHVɵߏJz<F#GdQ>P!bD]mu2(1;@ F oIɠI Iy!^H>r'K@i {ک Sid<(TތAB.s\MK&Rh 7}z*(wiƒڛfł2g5οhNۜ=>)-xX| zUOg6>5/|A!9mriȥY5xWI圾Z$,\PRdfqK/-Y1-]tRr,,,p,]©\VRzwi ==.+[vq口\&xҖ+\zӚSv{tSS^lͳΜp_L6l.|f7sx<鞩R ֆwö] ] Yޕ}ƓrZmMst}-5-XKo5ua֣[&mYf˖-lyz-Ƿm]u}[4mmmm{>iOoim;ݿTGXڎg:>5ޑix<7D,2Dr,+9G?Dã]SŇX4>0"ɂO;"oh1"C!Ywg擡}kX]ސl%R1!ʞdbAk~118ɵ]x?ih87b}(ZքցF*%\j ?bϰ Q{ƅړNظ')aR6)DAV5yEk:DWk)lW׿{XA#-(v_j~wI#%At~%#՚lg_ y,Ra'léɿv7jN[{SY*oi9DJ #;4@"ceSRSf9hfAk2ٌ} 5`-~ 5=wI={?>x'7Gp7 1? >>> ~ ># ς?((M*%_| 5_z|9}7 xX$%`ʣZOC${tIu\:> ~ | 6]{۝Y{;fi2ZPV MDQDp9is4GiEAHEDP%"{9渄6,MLLf:݉{Ds^lr]u] ˭P"?cY 4>qn+ѧY}:OoGǿK &у kgڙv& kgڙv& kgڙv& أ{b^{\s=ָ5.a}KXֵ^鱶%m3J-S}W]נ{|ߥ{ _%85')U]"S>+|Dώo\Wƻc%7;Q[LE^5;ǹw/\9v:̠ґKБw.T9W:+G\i+JGϖw[5 %.e.Yplה?{~WeegFkpB ۃ3 {!;?{o,NgLQZٝIpul}_+"%Y"%Y"%Y"%Y"%2۱}׃L83̄3L83̄3L83<ݙyzg68 lpf3g6Ly䙥=*iS`o_—JPcWcWcWcWSS q/K6Mmr$p4q,>0p2>Q| 'p:>3)|g3,p6>sp._ESxa<_Q1,xK $~4x(28-2V%E;^C^XN׷Tע5xkюЁױjЉQr^D}꾘?fD+oǽ`% *Kb^*`]Qr[*DUA8DcU0+1:G98>gZmNh:mSQ*TP:c4`O셽`?f`&_-Cp(xl+)8{ ~xϾ帋1 pk,ո:v?D[eޮh{͔hF5DyekVCWM8*0B5j0 ǞQz^ }1aLhdA8P>cYs$p4q,>0p2>Q| 'Pg>3|gs898_̔/|G\,ո:7&uLy41%Xp7~efއ xƣhcXj8e9o3xy?mx VUE;^C^rHə"9S&SR 4 4S{sWaUx&^WaUx&^WaUx&^SHx9<we+X4Ttb}0u`D}1a5<'JWLi|gr|gbs+MʧL3oxM\勎Wox+Y)N/Wc^Yׯc:]ACF 7ʤ6G&eMVWvY++ͥQ!.6eF'D 8 U`aW~‘8{=Lޓqj:-h5*0B_i`jQz쉽7A"V/c?p Y-jqVp8s8D<C&qώr&qOpi2|spnF_E>.|,o?BZ~zޤU׺}xR/rDMejjMnL L\Uf?HLXEݓ{u`y_w޿חA) g)2L+U؇TchShulu;Ejڜhyf V܆E?/K܁;wn܃{+܇Cxx-QQ*p)S?m;ѶϢmf\=-ӾѶi p pnBr -[(PnBr -[(PnBr -[(PnBr -[Xh[</Eh3>F"ry/.wpsNҷ/r/r˽]ro{ۧ]NkƏp~]\jW.vqsMbKqI|* |S$"x&3m*nPtݠE7ș&4q3MiLg8ę&4q3MiLg8ę&4q3MiLg8ę&4q3MiL)0HA R` g3HF^B#?>̔\}{}d;걓걓ߋyWyW1s1s1sHFj4RhF#5HFj4RhF#5HFj4RhF#5HFj4Rh\j̥\j̥\j̥\j̥FcP 2>RWx2o4[咎bw^rsһWɲDb:7.v~~_ژYGUF uh {c$/c? 4,а@ 4,аP{JTc8>IO8gq.DžŘ6.w]\=\ \&W?*gVK7DV'r!|W%u[qrV#rTc]7&gYarV&G!CR?~H!CR?~H!CR?~Hωl|\|_ėpk\-\Xo|ť mR7nHݐ!uC j ƮV7 jR{څ2ѸMISԅڙD;UNStJ>t"v]l&GK?\-\r1+Ǭr1+ǬZMԛr6LVLJmӋfj{&{oWݷﻂs)\+_uǛ>YZ :]=(GUw^uUw^uUw^u)|9(|9(|9(|9(|9(|9(S}y՗W}y՗W}y՗W}y՗(gF93ʙQΌrf3(gF93ʙQΌrf3(gF93ʙQΌrf3o+x{K!&ͥyM6ɿ<]>ʉZwD!}Ct݇螡{g螡{g螡{g螡{g螡{g螡{%݇i` .WEW^EovE?Dc''D;34L{Anp)_e 'VU3wڋnd$}c.? w xamtt881?5^e. RԨFyP# q ޭ޻ N޻w{zwX3pݳx{{G9uy lfoŀF1Gh~_LA8{A^⪿) /ƽxԎsnnnj/U{Wnj:JTL5R2K,%Tb*(6 nf nf )6 Nm`/{)6 n`/{)zyW^ry(VXRJ(TRYJe)TRYJe)TR'F^J(UTRزh~lE$֨M2.Wg2=?F+Uw&^{A)y]5%;s忘)b-31e;^~ܿ~ߡMLƫfH:bUM[ыXAlW;< i שb|YC}w(Ƣ̤&vNFbo{tP[m*xm {#Zyu5>;?8,:G%1+ďh}lTYǵe\[ƵeI9)85jXHW̋ӣkuE6/75̏֗~#m[˂=t:z*R\J?Oq3~[uanwb݅}^?κG(Z'-z9o9jE.S Խ=_/:%FVZ}{x{Љ.z=>{Vn_QαzySuj.uX7L]a]j.({Em{ jN͙ WԫzuW6WxJTc`}]]_=mOz;ff8 CPDt7y]z^߂[q[a̤cR1L9k>-^?%x<ؔxTh7~kQ߬'um6Աcwͺ].ܠYGu-:yMܢK:tT}ߴ/0dkmikzzTTo*skf WիZ*TJ䝥LifyC}uȋfv;=n,5 r(/-km?^Yڬ`k`m*ztrD.џK`k| n*S}wwnq>5Zj:e=鵞۔5W&Wr\SjmZۡvJjGyu;N?V65 ʱJ},U)#**F=^-TUbU-'8,Ӻ<~G۷kGˤ(N]^ҭS&iML:eRIQEiiO|s{oy~xԩӥo9Ӫ9eo(h70aTɮ$շ!,k֏#fsY#9u|xYBpkKv.40=c俱l0}2a swX +ŰB +İI>pCL7s4q\i4pϳʿ6T.v;w'&--\ŵNZR_KSi%J?KJҮ G|ֺ#v RӪ8؝Ju]w/C2Bwqwr;.#4ݯ#4y^ x=h`x}^Ը}\>.o}[ApSbyqhϕsXy{x^[E}N>'oD;_KE۶0n[q#K~e藡KSѰ4ap}bJ>fha}4a1ox0C 3tSjT{ );(Wwttf2jPK+Ȫ"(rxDPAp*(kxuE ]h&B##z݉~MtWWUWW=H#b4RFH1)F#h#QH1 )F!(DSs׸k܎ g^^&N^"Xwr-q-v/qױk5x\5xp8[L}p~A 0 ( {)sHOzZm8~m48΀v gB{5l s<8~ p!tp1tKR ."XWgm+`% wa=Q͆9!=X \'Dz^$KFB#h M 6뉑J=z΂z50H` ݚK5zUKz ZCȅ3=`O_@p{>W K w'_CvN rCNwN8[t:lgץQ6+ >3dACh6p ]. WUp-\}fffc"0}018*T>L0 &Ó0X10G//l^I& i.þgYBȆq`v,ڳ=m']7Bo0s0s0s0sc|a uP zHB^DLXDLXDL(x+>ĉD q8QB(Qt;`'TI} PUKE:uк&ج}nmֹ:kezB/]b} ` Ga lflfXO%l}`lflƁVZ+&kbٌ͕8M(H,(1C鎢}t!s9^/ >9>9>9>9>[/3G3G3G3G3GgIb(hw;;;;;LpW|j>w5śglhkg{.\ ?+tM̾EleO=6P6'3=ٞO) &. ƌ/ėBHȱ$0C=:m;8S%:.$~? ďBG!c6c\sۿ/e?o/XiVZ\[\)sS)b,c,wc/a7q w \vGeݸun\֍\;)0 `L0 a<OΆ9,<sEvI0#`$<0 F#(08<0&dxT(i0f&SEvfT4t!C4A-fO1Y>$Ǽh %f Y"Ą(O1C&G6,h14 HRDD(4J H(4J H(4J H%yD'_}Oɿ>'_'''`;쀝P K {"b"b"b"b"b(((((4}MD'I4}MD'I4}MD'I4}MD'I4}MD'I4}MD'I4}MD'I4}MD'I4}MD'I4}MD'I mt+*fjL䑉<2G&D#yd"L䑉<2G&D#yd"L䑉<2G&D#yd"L%%xD ^/Q(K%xbKK2b C&KxbYY0ԕf諧}7§t!AfBf W?/Ŗ|SdY%˥rܨtEu. s;E, %r \, %r \, %r \%FIQit%FIQit%FIQit%VӴ 0 ݅مU*wE]Kuɢ.Y%dQ,E]Kuɢ.:GgL3}tљ>:GgL3}_W*8j8 2(2(2s#3O%I_%I\B %q )2xR8H(R8"EO8"eG9Z%kq)AA:؞):R(.(#H Tb|/Q+P+u}ңݟ׬){ wyp]x w> ExۏQ~|dC'|>*h*E5W(Q(!o-|>G!MB!MB!MB!MPVbMG5jzմմ4 4 4 x$^?Ox$^?Ox$^?Ox$^?Ox$Cuy.塺Ef_qF_+nXe,ӥh,%|M{r;^j~kD~6Qz w{"~>_$٪YѴM+.t.2QߓKavrorZ[/Y"Z/(>:^Wɏط1>}{ɝPz,RגGK8cg'ϗ"{5/%Տ)N4WAs܏B?_o}3wi?u j6ejΓ\/sUnB"@௳!qȄξtԞ81Ga q!_/Xj "` D C= OK bA,1% a; bA0 v-\Knp% ֶ1FHxaGQca^eL$LP* =lB78홏qg++̳*܉g>-y@gɃ5)yTyQV$呚k!kدk*U-e,eפSS5/*&2jPqgR.OW`0C~ 0#`$mVmVmVmVmVmVmVmVmVm".UA ,7-X+aJ#X`#$c> E|K׊">Nvp&uUyuZxX\X\^W:,f1,7[z?g}>?g}>?g}>?g}>fSxJ3x&T*§IEx5|h$@{lm=4ѿ>G_}ѿ>G_}ѿ>zZ^Ѩ:SP Zћ>z2Shyhyh2b#`.g]  w=ƔLD,Krh~  Jz+c5xH2o9e-m ]aϰR\ZzS/͗96BHk;Ҡ0 j+rqo.-pn..͍OCP'lfokeٲ4ԃqZ.G m燿S ҇*qçJ(wsZؼ,]g^\w9o>ĻuP lp .d@ I׈cdw 3KjDMkTU`0C~ 0#`sx\ %:[:VOs:w3;TIK-ia'-xzڿڛMlhe \>>Ο "YOct6%)MIE#QNECO [̖8]qԷ3@G*<| \G#WᑫUy ڝZsg1m60@a۫5_K{RfzoQn%jj,JjѪ[$e)9=eھTqf}4Q.:-0TZޡ[uvFf{8{y^!q' Xެӯ}7p9G#̑\Eݪh/:='-i06 (if>U-JϪQ[zӖkͪ;dWV@p72gVBK44gdqF.s#}`\óp~rYUrL44w';zEI>=KQe~w9ra;o=>96}-p+~AG鬰t9-.cۉ]ɋENNG*aN[a ;a ̺Eę攼+ĕqPVV޻1OoWIjҷAܗ2,um>ϧ>O|+7.n[a(a0FPs&!Fe=>81ʋb9 2zVε!Ogt9ف9AuIhf6RO\̶.#ZmBk ;!Sw93^U3PDוʮ+M}J} %*TWڿfNUsjZ>\]#,d܅M'Ims=y85AsNT1mמ9&{m"gecv!\wI5kFoCLY"ʨJE#|>=d͚2j -k9vxiuk-/wpXDRYBO' e~z};_xܙGȏTYQ pUS8syZU8vOkɱVTXE0*wx՘2Mã~XWD^zn?,qR~Q~E8Z149/AJ̡ xO2eZ%[F&kpMM%8;M+;cgGD=rJPoSJ]jI?}-8ޒA\7h#G5{yϾ4c 91ʄ}LKʴ")kUwGȤplO}}Y!3+E]{ƾo{O#^Ӽ`7;789(󃣦hKjkȞppvLji\/3_s͙?wAlUZba[""kՎGjV}Ζ55Dz*RؖhjTfQXQtTX53"M8#WMjeD5dFE1*ʡ\3ʝ@$5ɔkAkŬx e)B+BUAUGedTlB&1ۛ9+ܡk򏨡zVxmER|Ҭo߽;ӈ !:s)xJ׊?:t9vXŝX,r'1Y$ψkk+69F[ѸĸWFz۸ѸQ5n2@qdL|nf< Ɵjyki7;g͎FG7F'wFgBB\"qyyqͼyݸi477}[Kی;@ sq9c4ǙO fq9ݜa 1156ƚ77f,7mNusXb5KCfRHSJ]i˸LZ%ljl'ʓOɲdclkN[e{ye'c,cTyƗny#/Zv7f/=>3"af!G1Y qP.4UYO._7 FxY&wdf;Qf'ZWUgSc̞1ȼSM-3 ՇjZ67k#H\oFJ#"E6Hy,TD*ȶvsKdgdYkVFG""=HG"^˶2jUOJP*#DL~mZdu5ud7Y5 o&YTkÚf͒lyǚg͓ZE_enXo;;rZ#Yz9h%Y`}nmӬCΰ||)l rn/߱;ڝz<<;ľؾLnjjվ{7mv+!ҷ#R~,{=]LȞeRgT9{jjKq {jk>ܵNK9E朮nu;NG999%%.2russ׹ιN vnvnS9w:waPg wCgwWc 5ΙLV9N<@&9ENzY,TSWjٯ9jz`fDUT¨լ(_h"ZO=mmfGhN4Gwr{no^vow~wzս˽KvݡP7w;R-vǸ Rw*w׻Jswhd4Ϙɘ1'xk"2Vg̋ٱ&USc|=R˲cxlplU/646j{ʊ[9Ve 6j{6>67uثobǖXĖƖZJco޵>}KZ=c6Yb_X}b_Zyñ#XM\Xfܴe=xx#k\I514~5)?ٚooiGGZ?a=z!>5^`ggX/Z OX/ş?oiffZ3g6<6xŒ>LFD3|&g%=^Bݨo "^Gt_ԕѴDZ c/yA Grw+^GhԷ5lUُV.{PWc\+oZו?h2Jbo2bm~ޫj/cr5^ms)wz.Qyٲ)xuֳԃ2[ëMݫsiM6Ws"uG>u3MO z773b{ArWۉޡws{]ك?8{7cV̑uQ%ң_Q޻~yƿW_EX?jwԽ9Ee< [+dv}#_{`Tj? :PFO/fgL[5?ݺsm>|'_OC/fzT;5a_;cٱ ngѳ+Ÿ>b׾ucATۡ? apNm yD=ljȗypO)y <[z2y [ |ZX| < nkۯɱGKu_ Ư.~pw2;#PU. b]|Զ jENw5ue8]8c^b]'u"X(^{n+xtCt7zŽ+E^1;~oR 7?5?#2\<&F;̝ 1fy@3j1>p |p(gMD-ok51Ea~Xe-2Җ$IO$> HIl ''Q'Q'5i!'(#(#(#3pQFEe4\qJࢌKDFO'dcMNCig8'w8͝7ι]8[{pHcA8}2^ĸ?"Ќ2&#aLՋ51[[`+1 4&Ɔ@,F*@[oTh|cO~78w&3ăM+`a3ʼY#7&%?MDǷ-#UV8,f"*2pṋUO|$28g}˜Yg͛!x4ԕKI/W2/J]fL᜙HT$᪐\$M%uR\ޒ3 (g=9k:gǟ+ʹ 7yh'Ys:Btu'2$e,4:KRb\?GgFfJ[0F1FQ#:TIFs=i͛Ismqkk']}uj~th >}-i4ucPf ;g`4G3њZZcdL'SInuf:3ֳֳȟeB;(9Ϛ}za*kRk)ɛ֛h_Ƥhm6/2k vkCo8Y=:>֏z:#?fCǭhu⭟Iu,"PX,p8 G`#Ҁ#c`cI(4!BŽt)Fa $#7Dn$O#RP2vJ%!wP)wb.n=;>^~2~ARayeȣ(sLEʓҡ$NW` Iq/7UDz"QFzr=mcؗW//////R֢Ij}C4 VՆŽד`d*dt32ڌFxW00N,~(ƾhݥ(gwn}~~+`Kcԫ#?WEB4Fz>R+p'CdNP] ]55+ՙt5 v-2`,KzYLnnc݈ Ū1E0pnX(yu֝ ,F " XfYY1@yh?e+DtFk5& GBI$,ƸF7zpm5ssdZ3(NgK C:-ͲYZmp-qZZ"ZZ2Z Zj)tB@1Q,l #s`GGe2゚lF"9)I);I< ь#ʟ( qgB) xa""H_!E'ɓ2 #=5<50"Q-(efaF<6H ցqgy[[BQ3-+++F‹;co 1odžquX|?+u?ޖb[prBжvC_O!e] l `Ni#Ϸg]VRU + |N~3,߷?a-x>36tO0ЙSx@h-vU_ ^+|?Wj cl S9Ⱥ1.(9{^c;xYuZ/k)n{92>q(ޑ -W9][@AHX¹+N+8CUg3Ma7 4g.I*b@^vfNPq?5:`Ԁ`b_??GQSyg;x-)tnV%C{rwgKv_;ߝQQỌ~<|S~qI3Lp ЖH)Vtv_d?D:4Y| jD<9?T>?Pʜy~7'>?] yl3s=uv4ӽ|7"p;;:ٸϨ/LUiw}?)g(,:W * z֯T{*YF/a*q)ΰUX-gWK/-N?* 0^wsƓVm]K [*PG/?t,(Uu@ݟ%_槍|JBY7/_\דs!ξk99v,.|qppǣҙ?l7pKg+-2u/YUުOkgXRRIW+zש]?b=W,DZ^W'>Sű8O-5SZKhqΏ@<~m{yQ'>8kSл a\H˟}Vqxb9i̩BiNpwZ4s wA39TYw/+U g}9RJ;~Yvw*p =RSUwgǯbMfQyjgKSN?.~۳!aFqa/޿]13ssS̭L^?_xC3OUmYt#u1|Fwtnϫ7z5Oב;U+ Oq^sqpr<"RڊGu!nwyYs_qB?g;V}<;7Gq9!ohDXD ߥ^.U`t?n7F߯GCR 5mCډo'ΜhH[ y^Q>|%Tn9D){8~z~JwrH vNgN6xop:7բz5[?W}ZLOKcӼx|yXētqvTgRBsyKa^WaCOO"!~M賔>[+=}-(=MpW*=}7(=}ѿ(5foWj6nflJF?%l(J`QGh\& ] T(bHõ5t\]LՁiTgQ}jL65EF}mnM2yn7݆Ը=w%kGCi8}K4h4y(JRc*>rh PkZcMÌ`zvdE$6`hs挡-Xm,|T}2J mی#lS gg?ڇڇt >^+YM(_۞ oouTSs)M/Q-\6#e@eok0.a\N.v52k0F`NFK=@꺌P#=UO P>l!jnֳaslmmG8,p9=]~3[ׅߧLS+C}"y\&)z5Zu=G\3]/Qk5JN͕^TjV#F,5SWj+__ezc=y r+WllFc Yd[(Enc7-i^;k=TM]Q)8l+#q= 1q6~6~F'MAn(4L4\,6EX QkAy`-  BP+(}'] RDk   %ver͠'`3('Q ZLF˞j? yyXr(CMס51B(I1b`<>FDP&xO|0'sB"5"2+DY7a",VJd?L&oh_2WR̓yT[|e@9w].,"BY2Eҋ2%[C8ٽ.# TŽՒe%&Xr h {$'>&Gr 8lj$.N"r.̓e2Bj,E|[_K|C.EΛM)‚)¾+ߣ \2H~+JSrȵh<a7ȍ(I~_ɯfkj ~MnzeR rg4QK=zp<=㩦ay3y*Nh,u Dk*NqBmpT>'%gG=勈Z BjB 29Bh*_&r\o7frΩr\+!4ؠ=* ~*W#_Er\*6h%-7!K 6-jp\n[_'8FkQ#Qk ȽQG>RA`ZԈUj RMQ!?*EFґ`b &H5YSk$URJ`FFRM{④vRMO'[R#VP`z* Q:JAATDTQ!"x#_EADɞԜLS+= czLX1eH~0-Dy}" A*A^֊`=*7iDHӐf"UH })Z$ 9QN|(ۑ G:t(_ HQ}' " [ $V~&RH]ݑC)TG! ݅~\'x>"TxI!Ԑ?=f\H!*SZ?4i+Xv5Hӑf#EZ8/CzI]6o Si߅"D:tF D:Ժ|Pk.\RR6RGnH=NW閰uփkQ#aVPj4:T?Nki,҄zYrշǑ 63愭#-rfvRtBY`knF&ւ=j o܎=#rmo&6~?Qn['x!ۻ|~;kyo[?^*3so)?) 6Bޡ]#SU~̽럞@Y\a7ydzv*l?tlػsa azÎ(V.+-,nrec'yWN^8QlΟlnyܱ˟.nZ§+c[+ey®]=Zi?,kU6[硜1{U9es*ߔ\/&wF|ʼn/8 Et *}wq3ؘ,lش⎰۠pQYK{s.,hVܻi6K W./\?Y]ܟ~A+ \݊G+wU{b{ v`L|v/v/9VFr~]_-8h/v[$c~U˿p^_k  e ؓ._Xo MjC} `}a|C T(lpowr|؎f;6767ol7LY֘-x`[]|@vY$i, t߷v;n*g`~%z%  Vc6l͢-ֲXÎ큝0Sc Q*l(j?xNϭʙ_UaUΘ=yZ ^4Wc(jWi*KJko]6&LUm`ה]_J xU1u \tMtқ*>JJql{_S'P>Xiۻ*!TZ(U7>,Zie@z^Ϣ؂ťl+[/{{㰃U )קh``B^ߢ! JÖvBjkِSyyKU~ O*xxUg3)^;+ET!E3JF,)xC /_*7hb`QW%&[6.(oTI2m%5awd+i&*8T9JZ]49d5K:+X>@M+7 E3$Y lۉy^țV 0@FIJۨ$Ge(X6-,z5j@!lK*mےᰝKF^S2g8>%aL.9 dZ hgi`̀%3k/{_Grմ 0a0`ceX111Vf5]]_tWWWдiaNZdc9!VpsXƜe&0c k 9Badl}3{/Y0 8(MC y !hvI['?3tZ9OzjG~6>>3^;bqi<GY;U.`>E6y.<;|wRӲ\;-zwp[;+mxka<=H,I{8vd<=+>ȅGZ:Oq:=gNo8J[fNwTOt {%Gu]UQײg1;=2_6,1}KCi$9tTwcx|Z2~G' `vt>q':8i㚼} |bŞ4u7usЌ\0j7yOb;i$6 84aXWebǰl)ub,Kckv̴,u9_k/;C=W-{ל11Luapt-;O@oZ-P$EpK1-wVxu'm'ʭQX x~&?=48mͱ"֚CXMNO˄5x֣8gG(n-!XF5gW˜5G' XӝCjŚoYvy8 EAg}kA_ΑM1q5h=oٲ[YO8'[vӀٖ=չ%Kyssh;W[/Y5Fe8VqnC֫zڥ׭=jLz'ް7jXubCjvuDkiquR-nkVK[׭jE=nU B^퐏.۶>ֺցqi}hPE?Wu[[t ϲp,vzA>]mj_1_M:^3I(`:t:7 shOO}KkT]^+M ]nӡgvYt?L׹|qE qzFX-؆OG;SkQd[ 8o'6=J^K]iG#W+3t ؅}[]Iz E$~ئ]9/?Huyo}( (g!u:U❇eW\v yy$=ޢ'\@8g\\ \~ʿDz%j\*xjUz]]>z W1:G|}#6Ko.O'Q(7MS).i&jkkټieVH5(coڄWk 򞦝ߴ,;b9 ji |s(?؜⇚3Hs`?\вO7 2?\-˂"?۔ھ/5WNIUk~l!n4A/Y `' v `W07 1-B+/VyBRe櫰"~lMcQ!z0 d7vbI曁k‘Dh 7ÚW(j ٭dy֕9yBi݅J<VLT{Lu-ObpF=)-ݸsI*#ɂڼ^NOap9=ǂ+Bxp 9MS~ V-;€DhؚL:ƳF|^gchpkaaca'LpOl<ܪ„~%X"Ly4o0ְg˄9?b=“a][t1bC?G)1 #11oԘjTVLv;1?CM{1H_ABϠ ,BukȂDu_G+t3M=H}z$*2K)) PYT:OzQߤ ?!rF6ߡߡ:co)q8L5Bufeƿ!o7.I}xǸBqR7 n6j ^_ڣMLԢuL9M5Po*P4}Tl0JLoL 1MCjRMN Y9gM]ϙol(*MC0|4g34MK鶡ѴbZ14~m04R3ߙmӞ!"3/EfȌ#&#݆ȿbs?x?"99_'"##""#"D&_"d0_8a3F*107xF)/EX.h‰88)N₸$H1RQ)Uʐ\TT/Ow@⪸!]FW;UF}##GdFǢ  ?0Q~׆ ?B~&/ @f.3_Q Mv>gW(᷆߆WAC&@}JHH@HHDId^SJDaD!J%o1q4 (Nl|MőÈd&f9bX K2R< X#ZDNAUIAvNkć * ޒ ڕ jzB&%${\:!jKvIԙ/mKA秞~y' (Ĉ2D1gP!H*y/ V'_Sb@)EF:z |$=z O )迠# !4IG?(&H&CKP A>~ ;O=OS*QQ` > >"*z}zz }X ְ}M}Wɞ2~O񨜒( }rR*)@'zEI}Dߦ.&y?,zij9P!+#j67gDvOsQ10 b.2!'y_F%\Zm>m>al6~>{7Bh"h h:h־|B-!QH҅,ᰐ/ DŽBpB8% VjG B#\AaHƅIaZ%Ꮀ*lmaW41^LS 1[E´X,b"Vu"#"W b 'WaQqBg9qQ\Y7-b S5?ȇc ˟',g  .$avyOG @|f-T — 6RE2,𸒚7402B4fqqQ5.Ћpn >AA@Gu|#y%e[*'A1P(C? Eᇕq#?ʤXzB-'iԟWRV=O)UgsʒȃreG;*)C=ɯ(bhZCXST-eWR|8 b#?{N84O#rB3^u&#OL*9G*d:s?:B,zO-pcu\ GHKBO㒾$T:?ܷ:5N)bu\O Sdڇ:1 9; =}w=X/9ҫQs]t_9>ӪEn8S8r*r7H\Un9W>jp۹vwoW}x[ 9aݹEJ<9y?)FD{OCJe)I*"5JJU uT4b.SD5]f>Rz=l۟2l\FIGԛۑ<>q Q:зDlu)GǍ/70WmwmлnώuHmB+URzOS`"1C|<It!K$etWuIWJ]ضgz]YR0Ҁ+_*]Lj]BuǶSpz) iuJsJ.]ZsiGb}M5GryvyU.]~\&G:XW=a_ԉuߧ}nrGNv]\᱗3]rkHsqr(b:r2B1''Qy|,*)wba+X|$q_ ɰ'/$\LJx\ZHekR\Ӳ%ǪkAnr-΂};rеJsm6%.O.kfi1d^]ĶTⱝmڟ# - - |zj^ؗvS>TƃCy<[Z|[˖jvDvcA~ox?߮ovi2m&=>xl'ii3Zcwm%a=eI= M qUǽFcǃF3~N5+$|,YTSIe o@ܡ$6flҘK@Io$m tu㹰>ׅcOH76ñq1n+..ՐU!]&\1Ox^eiu 5h&6jJ1Mo8yʵZg)q7jDZ_ 6`׮4hpG}6СM5ti3 =\x5\e V2m|k[904Lk{ nyհ"Yrbpǝ}OXqLٰNnpglv`ۅGî;py]`7c%xw=}Ҟ᮱g-\7g/rbwman$Z>}^`gܗ2v}^=ྎc@{F6ۻ7~랷o.^SG)Cp?t^`m_p=}MOʾ۷,~ؾ;z#J?;Տ9GA z#Y?HO;2ZGncyGn8k(&\l''.+5zâ_tpz?wUr4#ç>A}qN t!A7MlYU&sy{^Ǝe`+&;bow }!TEsqJV(ʥsY,orQ;ʹ)rHɉɉ~D?OrGIN $'E*JA$'%-!9/q ɉWINjZP9u:Nr$' &ɆVL1'ɉ~D$9ѷZcƟ id5<ģ\&IbR &$91L)ST1D^` 330s"LaQ ցtb1|x}đc`^`s=+&•H`ʗC8g pYh'Ll.|<\>aģH@ -·ax_&Lro2ƩT,dtȸFF4zE%#:2)F4d?Nu(fQߑ9OR?aDͅƃ2>OW=- t]͜B3O si%$%Zu2yJt F>ް0cP]\+𾌆A&Ļ XrPsi&m9z1,4/+O4 Z @oқLyJ%%; {X qcLTXLBzIu!$6$KLv>]kz ;f}d)bzS3$r LS!SFdQ\̥Q Us(7ps"Ln[Omr[g3lkNdzԖg-4ǖg+)[%=c;k3Vc8lSmMLG+cammllmWm׀%01u \&St>^|!?RN8^v'S|-S[yh8|B{"c?4?ì^QƯ}0Termvf=3nYNU#r6&XX]a./ZRq^.+LJR6Ek-ӌ,08T[2.Xd8PnU1'w^O(<wE"`![ǍnruA^L^qMyKޑ)3d튕 Чi%u~W,`$!:\$ &uB6LpD(bD(**9) \Ŷ.W+t B/]0, „0%s¢"atMaO4rbK_m[\!{rhʱ]c`oNhWDߛC9"?={t{¢wђ xZ |-fT)lcuJ];utBߩB<ڙޑ3I4_aZa2H&uQt.Yެ~ں k%[֭7W\Y9EGs՞j @' itS5G,Y 1Lyd-sbL$$3Y)c>VɂZsЫBk)}f+1c[1{I{/$龕g*{KLƤNL b m5vcKyL䔘؊S>ܯ6ڊ6,&<6WtOyR[7$dbsccb)GUNB' OBMcԵ/'_F1/1+ bV-&I>>Fo;Ttb,+'ˑsb,d_;b;Τ(+לIJ=/cnR!玤A>7L.$9AdIYt& -z[A|\T|̴\gAN'cgyx~`cG]Aw̿>`l_$G΂+;-s3lV:]Vukѵ?%x꺛^||$22/$1/=}@ʗyΗy{1G!--gT˒x]|Pnɘmۜ۽(2.vq9ܥ#~SsX\aI6 y*.g\2#˙$c!\}z,fsw|g/g!0.>D$j;EBȄ 97$[?&:݉ k2d8S^]5+UgmhA(+#HyB=;˅BBW (tMBn$t}B3f =ГBO -Z&w6mm&sO/_( eUNmqPC&Bڗ{v*'_%4@h0Bc&M*CBs*Z( Bk m"=x*<_f}ssPo`}B_|*B^+T;TT)T3[(ܳPOs . wψ9+O[a *_۩[wb!7 -HLIܛ(ISG%'%$^NJXؔIH|6cPIf_4I6JH으< WɁ7A&'%J|z2trqrY; Ro[rgrOd:eRSURjN5LޔjjjK%S=SW : ɩROB/VVBkS렍-ԮT?*/;pS@A(rrA5o5 ,Ȗ\kVЦԾK dO:/._\* Ņ(P_\/.d 5hhіΡѢE!.ћ7GELJщC[kC/Y8\-<,  PY9^IVw]lYAٲE);f7 U֦ܿ/x1й _*'%j&_v"f6 $%bz'&C7$Ft\bpSFnzԕXX"su*76~cÍhhא,#6*Gy6:8tf荡[BgG'Dʉ.. 5})tNtOtO(p/| J[o [ol̀?~ݩHI`-qZo=y4ي_3G?; 7wCSg IL{xxדv`D޶f|;ky'F77w i *Q P,wB>TiBWʩr|'xbf[`, ["ozi=:ʷtgRk7a~.;w/>;ykp`S%tQk^  ;Cɂ{Һ3肛'f*Z!Ew<%y SIxეBs[Mu٠(~\|(Spxn6Eȇ~8SZHi-Pw'^yj7 {7TH8 T't[.(;cC!L'J/Jș7 iDv#| ԪAԪӔ>dIHK#!\UyAGQ-n@0 @,u[ J%K"E"ȗ˸oMv-zitQ: k6 k6K$(}pi׵-fR+}/ϲ z;5,q?2pQcF%ր CzeV§ЫfʇDpxHH6p6G{MQ%' tD!$I=̡926}ô2A`=:k!mg~ d*Iw2g"DVlo>";΅HOY? vd|뼦rY?eE d]T+ |$V!"00t6%#}CJY kS8COU ef22NƼmcʸG匷֜#/ӱ}< tdp=QiѿGiAsAJ7Y"Қ5)r6;Of+m}GI=CshKl!Wro`Nhkm g(vZqJWi}-›6szA"ܐه|:}`''L' ف ATG>`ndcsF'<ƈvk?ó0WV/y9 IKbFy3~M0YdLquZsnƸ>1[oni$mw-a3j_@.f`g;˾ڂf[]v|y',5{CΤџoVka8 Xhg&5R]S|ǽ7Xwc@ ^4A{M L4)~/\" Tbbm* fh낹`EmѼ 9a`EXHJtg46X{4Ojc;)N!v FZs;~5j_oX#}^^elOADr|؉,'YGjkάnR$ѬHk)8n7"pr*uQk9 +)#Շ:RyDkVޟȩ->o;Rw wgWEx/"f/):釾 _?U^Feü,AȬH4ژ%*}9F^4|=Yxh,xhN.ӐL;ѕ{zwwDakv5ʻπ# 8G5/h΢nwE0 Z]۰p1U(}Z)F@~:f:N}NRYs6d_bf?REjwUD9T;cޠKnu@wp>~Ω`2znwWXN ձHnW#G#iV{~"?>sg(MpCѬ o| w_[T g|ZTb!= 'ҕp3'8I;tZOKzBIsi,lfi]o4h˫ HĎ7)Gz Ww(v)k|?Qع"^R;3އ&\BG߉fWOn ,v4*75,!0J%n uw o| 8|INz祩 rMuzkv;xi];[]o8{k,"^CoSWF;oS+ĉ6c8'<ˈsI-7H+i14F-C[yc5Z-"?ާDE&zwx?#6eD7nFCKfĢzޣQ, _WGRh 2 {SEʽYvQtUSJt6Ws؋S܂UZ~Z7?3XFmS)nޖ5u2Ǯb$>͌fԪ.Pu#_o&dM|oPQAcĹn#7> 0WmԽ:;JFT O&՝wms;L?0k=_ks?O7YYz?z37in#L~!~G?|P%~'OS[oxQ<{^W;Boق:Yݓ1g,Vdo{ه٠(+h;>P1Աx]$P-f nxsfx+#' (ߡ4 5d.vL8<"x ;dg3|ys sϬ5o_0/:pww 6HeH÷6b_}-1ި7&>Qof#=Z|"ZVtK݉x~78,ax73"<z0F bYE}Ev~wjk=8Aizj5qy4cχ%ǻDC=Q*;$EyyEg y?.M='vM%7r^Y{B[yD?q3܏߈55@\[|y}yCf 0I#4k[_& l+k̪d?WK@NXЮcO|,|JJ7h%֒;K&ܕm|0T>ݜw9oo`.XT YxHNGR w w̹`/pwy<>-ۙ5<>ڽEO%Z3\"=N *dc~`_X3\"@yW-/~רzi!7xL^G'(D}ogzJ|vn^uEfBrެ`xo)JfxZwgp+,R{{wE)mT'#G={oeܨ|zލ ۉXQ DmtY*ؖ{ "P9w(/v"<|k};aFl#& m-0̡^Un cN#+Tgkx"o ֤w*|WܡsξߙH.f)=_Q }>o/Z] y)瀓A?AKpd4Ś4|X+?A &tD 9<;# n')*HZ!Ew<| gA݃Hf}5Η`{j$` Id9C>?Ngy}Fi͇ h* Dog njS9sX.JZ~\%";.,`3; N FoP<;:[늤QBzXHO3 _OQ-r!m) ֢'Č;UR?Z!^Djp&:EHFԷg[PuVeOq9cc>O |Nx\Pߢw@>UB>t;c}-NH/G>* B~*XYx0X:_=YfHp3U#=kA¯mTqDs>>ߋR$Cޤ3YyXj ݍFO)m Lʃ݅"yI/me .G ;:?Y=t `b BJUA{޸kovOCx 'Uԁ62@3 zxy(V)fuwQY`\#$NЩxH!8|W{dX"UKYM)- p8jRvUEn'py[pDwfR98?wwD/w>;vG`:{kO w+X~Esf i/O\2ZuFOP}pjv*RB`oa-y逝CP7iUt6M-PNn1=aV+ZnDfE/`{&XT>Ě7ݶno65Wy[ʇ7r#p+$ƕchL5uւʝ w)wf{*R":29"W j?U8=>~(Mn,VԷ:!qWP=+oMvhrq9l{FG-H~WUt!UtcĹSp^out,Atfbjͅof:%:i:~MjTN̩*X(R5H:+Ts>ѵ|9h֢n KN4%njXy*n42;=pF% b;u9Y0k3fo:/H t"2I{| 84W(E4?_ DGc JR$Y`eElq_OKo 5!_?l!y~=`O$OжWݐ7S0V1HiM)ҷHdO{ba:=oB~oOk&(2D?wW <|XdgGy#ppٙV=;_7ؙBs #vXn}}bAk}FS`o~:U]ڈ:` z\{xɳ1`{~?h{1=17ҷ%/m ?Mr_EJ$ᣊ[fCݡXC'Gފc MD ;|ExQcS,%Rp xWSk1<_zAwG5x#r3CBll?(<=p+**}CdMy̋b nt0h!k O3!:s1\pyd͚\~Zc) !_'V|Fo7 ӠatóʼЙڜv'ri_GzuHV>VWI Բ)r!xIː A־>( 3kcGa';_5d׶Qd3̈́v?;}cO1v_#*SૃfK{*f8v ۔͹̯G<(  hΟ b9AgŊ؜$rfǧԼF]r{*: >;NZ? ^URt "++:g~.ൔ^ mhDRHG`Ctއ<ɛ{"E]d5Z᷂ \AxMkN7 E|&+ |x} \ 6n+J;a}w888J7P%r웻~K7`]? .p#֟u=zٹ~cJm,}O,v &ms%x Q f3ϡP#A:LD^Wxx5̋wG5+r3CB'Y? ?AbWD L>ؖZW_^pA+Ȋs|/2>D̥W2$С7?SABFYO2>VWIDK]r+?DX#^2B/C@"0 Q%%c狺ڶ^׃6lf72Q_d63X}Ir9d=#V5̲;g? eYjj"6<רKv !}']*6Fn*vS#]Fl LIsT||ʍ yzE>, t|1 eV֧ V7fl$=7i3$j-g2pcH x'U[k- Qy-`3މNZys^%̬++UClbz/sGBˎɞY||oJ;/߄Xi,P6W֐lO ѺӪ>gS1JR/;lOO'?&ώ"wݯ{*m ?,ěU$Z7+&AO\tj;V43+%G ` ov3Ewqg-MoM5_~R}J xEr/32y'SY=w)/1VwCjuQ}DJI/_!vtJzr=TwɁim[oAHoO"3ujhAYνi3U*.< lNNe] >)J[_981kGuN7xw*oD @V}w4={9Ķb?Xe)E/ɮD ^1RY[gfvyB!] !*( B1i"HiBH7" " 7!{%wd/z>99sly7u̺Oh,LfIN#3ɗiu4f(ʪǎ}N}L%z0m.&U$EQ(;OI%蹛n!KxAd(M ߠMIj]STK7IAtD`ҷt.4#3-P%BQM/鸐vjFi)ΖX!CPd!?s&o9i齞,,ڬEjD|бi.rj'MKPԡH< '4 oSMQ錅Ȓu;$}EjλiNcOбµhNXp=ǡMSZ?1uTg՟I K-!ҹʸxngqN~$K7$~v@=ğCq*h6F>uSIGC3iN# !BG%x,G1 mț6"o.z .!ЬGv8L9Қszĭ>*)ZP;^]ʤ7U,g*k@:9]PhO>ӑ XHQ" ٿ";1 5ț0{é:=#9Lu)<;^*ERJSO)s͍n7vJ눰 MvFAFZCM%!5ˋ7=֗G]rw*z4*E+Imwg T3jy@gt^Fǖo#?rxJ{R )aԇ.CiCH Kg gi]պܒ4C)]PQ)MߠRuH }pWJxLۈ:q2JJ^b% NuTJ}^A}E J"|O%qCnJԘԊ1\5h6aDOKQ+訳LOT:T]8@#9AGLy"nض[ot˘NXG*x +( %ס4f; | :Cl2@1VހYAotXB6^8yѣǸV*A-x>|mC =a(dQnjP^s@jJ&+axނ1 >atf6/<PWUԁ&]ޅ~0BGcOAz!dB8TH]BShUxp Ɏ )#lNE؉0od9H8™ GF#B0Ȏ]{ NOaU kkݩsGasք2@8p4KWc--Dw8ExGIM#sdifǝ<F'DXn6aƄ- uֺa_]t0‘' K;p:-to)|Ə+D($ʊ za"N9MYQ;MU4/4=8d/ygFՃ6NKSZ|44IX MnGuZV-&_<ο@y! EuSd {\yĕ\yj weWVseԽ(4,#R&_Q|hQ KOߓ&7MZ/X&"#R׏(&v4ZiSb dc!M"o 7:FaXTSK<:n[v8Po7Po71nj{ࢊy61| lo`3Cy&E8$J2$:b̄cLgiF0ن0ۚmYlJ,a`̞fOVX5f,w&Ο(«r"ʭr WU~_Ƞ "P^A*&2P*2p.UUiUZȢʫ"*luȮ*JUYU9T5UMTUsKVEnDNyUGQSUg_uU]ECUOSREaOEԧSj"aj(T_PJQj(ƨ1"\SDI5^*NʼnRj$J)j(ifrj)ʫjxMUsE5_UjxC-RD%Q~R?jZ&ϢE"RjQMUkEu^5FQTfQKmU[j.jjvݢM&Q>QOWE}uP auX=uR uu]4R-񾺣Ꞻ'hےb {^,%09^<3iyhICs\ `i+lelmeF2ۙ fX3T2\*<*|*dTTȤ B"YUE!DW* T)U 2 ʩrC^J[W5S T_QmjBA:AaEu"*F*VBQ/WUU@S`(PRP# B}Rj X5ʨo7PVMP&&kj t5*oշ𺚥fj<5Tߩ^}UBj1%PM-UKZC BjZM6 P}&|GmCo[O@o[_Bo@A/ڋ^=^:1:1}ucFcuB&G&4Smh}+k mkmX`2cpO'Xm}!d}jM6gxj4P*A z{r8a1u 8Wy~1~׋d'${A$cןdߧ${}H2o~LPXo/HN2K=B$5~H&ӯ7p;X=#cI~\fq23e&ef$.#S]FLw2,.#s\F溌se$e{.#?AM!Ff#&#\F2e'e.#][ef/.3+]fV̬ved:.#\F6lv2edvR5ȦN].#]F2e$ed.#]Fumq.3']fN̜v92re.#;!3.#W\F\s2rem;.#w]FUuDh+:EwC>b*/p%^g9q^\%qY\W5q]7-q[w=qG 拚&pQ[!Z6`v=xD7 "FĀH|-z#'&A;!WW2ed7^1r9\Fn#gךaJVDaIwDE){4w| ~ḔAFF#ld6B,FVr#aC^ϰ p tw[?>10" XsEAl&Yl[6];q}L9Bo^ Џ"s|gZRůbX+։6l1[+BE<@=܉k=tE!O[=3.g.:N[gvK3s C`(/`8`$||400Da Li0=0flsa ,E~%,e~F_ U~5=zal-v;a=z}Cp}Q8Sp=Y8\KpU܄[p]G1Ÿg<'dtAB!WwD=Q_4ME3BEW1P b &bQ,b-^O$8(8*8)NF9F8`4#Qq8a4N3Yq޸`\4.+Uqݸa4n;]qx`<4'S㙑h$ɦ oJMYYVU[.kȚ|[֖ud]']l(ecD6dsl![V26ŭ ?Ѳ$;.&Cʞ#[oGd ? ,ȡrB_+9R~-Gr+ox9Aɉr,ȩr.goLP.rI.W\,W_JJ5r\' r$7-r&r%w=7W r< C<"cZOvoj?ڟۃ!P{=ae${=ŞjO3o,{=Ǟkϳ "{^c F{nwٻ=o^{`؇Y}Ѿl_oڷ=~h?O3;Nvawc8q:sɹ\q:ל s˹q:y|>K2}AL`_f_////__N_._n__^_>D$dT4t ߷Yپ9=~|*GJwΧ1E8,(E㢋'0} '(1 Ίb<~[)n]uY, EkF,M˴Xqgt=ss]e8AZ[_y&k]Vt}6F; c~m\aXOaR*R?df "w<{Sk`Ȏ+B)Oú>>>۾TAEQ2Djg4~ۨ,N'=S =iOVǮ4*^WuF[c-nY=n7v|:l't䬂1Ew028c)KF '`G|1oϣ_oC=RVzQWuS\u+)昊+'h~; p28N;'dw^qr89\Nn'w 8BmyU~RKE?]N-V;4 8|>jOUFbgTNc\V* s$Dڌ a e 7=s/6PemkC8u3Yo6*86nhŻcyOa/P%_Q0O8z{Ɵ"SE"(sDQ VPQPO3pLogl>2e ],gKg4{G,v.fv/ҙ|_[jt=qiƢܒ/0( w4n`I[Va8n-¬0ZMQ biV|& [6[bf1+f3m1fY,l1_5ff`X;̎;N;ΰ;.̮! C<#X<O3(D)3Pӝ~& +n25-byղN,p2Tj⦠!n}h@k2@;;@| -3N!,,8GC βCvz;u!Ɛ梙EhCe=X,c}XCP(Ⱦ`áFBq*([B1mPt)f^k]tש{a{a"Sx(c>$+㊱+z`⺧ xp!Xk FmͶ怿5ϊu2ZclZrbytdCaǡ8D~"ЇRCieЗ_ϯB9Exlsu)dOK^j2idF\5IzyqH/^WZ-B1˺h]|U&5-Jii`^eT$oa\z51*%╉֨:>}5iTLѼ%@29k^^YVs .ȅfĠ16"/f`;6CAy_HW_pX!+^-S /NJ81O,VTJR_'[S4k5֚vZom6ZPq%LQRyJdݞ=mo{^nlWګ}>eW{gMUsL1\1C¹(2eJfT1d( hȘTTRQRIHR4" !}_]{a}ٿsx5GA! Fcqh4NN)fҔi*4UAch4 &M6Mӡͦ͡hsi4!͈fLG3i8'8?#g\Ùkr0C`G` |2,x(Ѱ O?0~Q7C$U"#ԣZMFam VA Ng"3b4 f?h>Dw@m }w;@}B軝^}3]hS{COzu8?uF\E; -vf!v؛M6؏Ea?+WW^#dE g|y_6u:| |_zDt'Y|}_>#9-OXb{E`6x10's|V[\]bcMMskjb6L+h?%?&jO?%p?'%?~J~NK`Q%ORǗZ?'_M/l&t |9lGʷO;lFv  )Bʐ 9G.ko?& f܃2c`\@QEGc3'@3A~2D^zA-W[~atQC! #3KĨ 7ƉqOBŘc /1DA^ yi Dn,& "π)Ll&+c 1 r@><,Ifp/_ DO3wL륈0?bJ1CHs{SA~聯XO$|2XHTÜ( V(iL0eplTND(EeWd4q ;bir.bx#HQ?$ 0wRS#= %+{ O* ۪YW(*A$Dҡb]bޯIs G󊁧IZHұ :,yEG2 YBg eL#Ę5t~@ȰQaa^QR8.c`CWH!1MIhY+(j:ߋDBrf8leckϐ'OEHs04q=PDalPcL'd&HWG$S{ DRKDQ\|nn)&zZweX^ccA_Wxۣ&|KQ_<}[aeޱoy+IRJ;ݮw;ҬhU뿤s8yVШ[Dn˶M~'[OM FG6hVqHK¢$8 **|ODJ7;2kU#|WDE~7#ӊЈ`TTV01)%/ E:|i&ILHs-;{.xm'2YsELrm[S~o~DvaQ>_P( *-i"|z!T?Jݽ] 9{Yzs)qÆw/WטqZd7p0< օ6W4qQUܮ9vjc7kwԇ'x|\x:OsUFn]뿒U)g5.*OIpy+ǔ+ԖBz~ΨNq/nUy!-٧`w7UaD޿->Yg34u4 b&ZꥬE({ky/UUf:? `3˦[ѫTN-f &ІX$0?@0H؃VVg( J &NMݾ2_S]{ڇoܭ% /k+_&mYѫnqTd'6kniJ(wCg㪋s%߶l){/~@Nx[BRe QK-yyV } ;oޭ^4x@ %ၛ $OET(f[?ǵODU A؟dz"UQDyI6'O|hWA j '祤',w zW!P8bA{߯b5m\ t?CuʄҤ:P0 \K}$ WDEF1% XKQSg訩ISZTf'Q0Za@@Hnuw\!ySUwņjܔ<o7>RY/ҽ}=]k6y.rB+3+݉O{կ6ۯܣձ0(=35:Ey^tFV&FSg}\ ΗZ:X{ ;h.2%[ӎɔq=`^ԮaG^2*9Vua<]Fk=!QBҏYN"9f%nyͦm}&Wg%gdu^wz<^#(\d29 .fb}2 ?S$/O4p|6>6!ݥল} Qf  ]"|؞'fZcsǫ%餓bҟt͓>wZ\)qm@[5^?n-w*_uQtnu,bLq%BQNL Vs{+u fZw礋y~f%x+[`]_٧)˃J7Cp5v /]MiEg_ VDe,<ǸrnΑx0K!"OeG݇]5t7-?E=Z ̫ՂǞ|F;?\#XC.r[5L׻^9EixsJs UU|][rzH5$Bm7jDg _pK/0tjcHpy>7TymX](T G?tRxWi_jϮTotش{4%ya 5t_RM!{?b^U' 㛃揷e} IqfR4㟐eAh3:P՘^pq&|ωg{JJeE;v/OώZ/RZ7yZnҡ=鰤r+Һ89f,Ƨ?[yk: i\u7yxBB@҈Hi=i=ŘOF9oZz,P0Ǘ]QѪORǛz2lO{  WfYh)Ԧ&[;%*̠U[DE9+Ѵ0m˕ޘ<ƽT0?gn}97\z_o1o%SE&d~aV[ַ6wSۧ{]">LƎ8 +o1 4iA&4Cɇ1 9y bj'Q6sOG3w0Jzq2^ (Wp|i~(ogr=ʜrw"bxkõM]4\IZοu&EgIfECFo y,[= 4$QlwwPM/;EomH<$Gؠ=k-E[8+kyU(3;jc%fmTeu|(+槝v.7c3ܯj x<-nMl<7"GnR\a{o z‹Z:-@Ԝ:|؟=T_YUy,a#Rqwnz૸Gg>؜_>J7:ִQuUt\;[:D7Y33 =*(R+ voOڞ#u=wprz2 D05#>HE,;ۊ도e޴o]PEHuLH5ux;! z/k'L&Ѭ.1o轿̱U/6~a]\X/Д%Gn5" ߦhg *6 i=v B7s!>YR*sͧ[w!Mv5G-W\Zs0hd~3>Ľ~AmYn´Sƴ#b 1rY ;!Y96s .m81Bi Mw)R?"gžIMA$^~ }JǸKUA_sgnnp'zxEL8;+R%j[~UkTm Y5[Km4^T{9[KM.rovvJcy#Cz^.yU5j Yяc=Y*,gG+__{ ""6r1?:\o"׶^-k/i*-)>{f5Ѫ;RoX?w7ToSKU_$%_sz\ǸsVz+(jPcDM H2qճ'EiX_Z.+͡ku1ߙV{&I'4]"Ҙ/-uҫfiW[@nk}YyM䣨$Xfjq~>|s"f)oX Z7t+O[-:JjǫCmfD=N=ybƅ*8*c)cr1!4uHrXF?~+": C[CGͯ#rd4r'P4_9Vf#^ЙWr2*eĘ!'6qLkL lüQ Zrѻm2e:Y # YJgꯟ\ǐ={@ƉSzZhfi09اjf.m]yjY)MՑf?:納&vz n֔j]B}ONC!W JVUPWڄgnS?$Yv9u#1mOvi6 O endstream endobj 90 0 obj <> stream x}K0 /oW06D R}]U]pRC5sJAJЇ=93vQ?\_(m8{/bomB4m=ўݡK]ӪK~wumwOeٓFY&{ }oɊÞo볏yr1uPU?X5ws>]gˈ1:k`rS&ʌ%LR4- q9S֠T2%)@b)wH2i!ng?"IZfݧw`BǼAb4d^ЀqbH#:!iC&a Dzͼ!gR䩄td".-`(L+odO ^ !G̤7^bVH%P! J 7Lsb%Vf:c2"ʙ|feʠ(V68J42:s@ھ8;onξ]DC?LQ?=> endstream endobj 91 0 obj <> stream x{xSG9%X-ɶd ۀ L1%XB/."`ckHHqB¦Jz$`B IHo$lz6n%u}|cJgx|Swf|‚qƘ _X6b=”o3]^4w3Mg ]0v=cȘq¢⯞AeW5W6~u2,0TU”1V^彣?5uskop~q.F ƺXIϘOc,uXdEY}Ɯ{Կ)iG7$ !zE̹g|y1%-<wngNY9j>~c)skO='My.kNs?Xϟhq]Ncu/֏vN&|b#ϛb#K4~Uoٖo9vȃGd vǎyP] azV(r4W JU]ߌ~>] 32ŦWE*Og[龌)zI1nS2.(1Sub4 \{IWŶ Y'-z xZOWtgחVw3h;Sm#}L?՝{GWqbFNg{ )윳>mݎwRa>z-T[gP椾i,`gSJ~l _Ie~ND=~%gv&[[YOWMe%5^WfUߙ0k`Lu[Yg.c]Yi.3vGБ:RGHRn榳[YWM'WѳPN IIYĊ?jsF`slݯf/>'sf_qMkmzegz!klWq m OQc{]|絟W#fz9lFgToНԅj:G=RGos1CfBD9y Yv23-bmy *^y| _|3yE8=oQ)o?*?1v[cԙ~ڧ5O~Zu' 㴹nȝ>ߞ_ohS*o9_Im'Cc[XՓ&VUVJKƏ;f#+.*,:ğ?A׷ONnٝ3;60xߡ'[jÖtLH167\ja_jM~6 {Tws*J('K\Q^5GUT]:3>~[6ޠQ3ni B[yE_ ϵG`J*9Ao(U+ IYYd5uVB1.oQCM! P+r[?iuIP)-C(jԸ>{+ܩA%W高V) nQkR[V37[O o1.P`Ҳn&.B2jzpQݩ~cHAc0Cb@]E N{;8(pYc¦$b7{+||>! 17k**Оvx<Y*eF),rǪiSGbo7At wȼAtDƈ{cktz)nmj]?o_T3s7WV1ȭb{U4G햍gh_Z痖UU3潴"pfhec'U2׬ xEFTQglV Z3f6٥MMG6f )~&\[/ʙ 5bsXߊv[Od=XجTCpbVlVfnh0Z܀e0z`,zvFJA X/:)JFRb+X.2)JDR,b'R̕b8OYR̔bӥ&EuRLV)H1Yj)&I1Q*)*\)&H\2)J(b+)FK1JRbä(HB) *)RK1Xs$@)H_<)IW>R"W^R9RtRdIU.Rt"S )ҥ$O4)RJ"Ed)pK(ERI+K 1RDK.M()RX0Ka"R )"KBBK‚J"Eǥ8&Q)~g))OR(R|/wR|+)!a)IqPok)K)*R|.gR|*'R|,GR|(_@=)ޕ)ޖR%śR )^5)^)^%)^)9)KHxJ'xBǥ+cR쑢IR<*.)vJCRxDxHRlA)~)^)n)N)bKqJq7Kq[Q^뤸VkZ?HYRMR\!R4HqJqKQ pppppppppppppppppR˰˰˰hhhhhhhhhQs(e1s(@ B)@)hm(ZCDV%-%-%ZBe)h!#:%C4;T:hLDCIi'#JTKTC4h2$DUDDDM 'G4h hQD#CDCaD!(PQ=THT@4ʆP;?Q>Lt 9h5OGԏ/Q7Q.ҋ'Q,;FMEԕ QgL:(D#JSCBLD&J %%Ňǁb"r1(Aev"D*3"Hd %C % JFri[Z*rlj_(3?~"1_!_r}KtADR7D'߈&KW}A)ѧDPDC}@>U3D^(\л w&"zUyu2F*+D/S^$ D=GY &G=I'K&r"I# b'D=LvmDbq^{!.; Jt;uvr+-Tv3MD[n7Pz눮k@e"hTr5]Ft)%D\!TED\A.!c. ZKvV\|92DK-RDC:<|9hlfQD3hdө4zYG4h dt5lDtu]I7 :;n^ʉʈJJBN?h|)0.{ly!hL 4"r".#(7hCεPaȹTr E~PnPQ H4 K?Q^1 / 9@}7Qnȑ E5{bb=B7sSntl,+Q3Q&QQz!ԉG}QԙzPd$"7Q"QB^ 'B)X"((86("+jDF"QSMU"1mGVi{C3l~~~{;}aoPw| ||5ר/ρπOa1!u=kOϻws0m[}.oj6&0%:0y[u`R^U`ⶪ@e^E\ԟWl+J }Lިm#FlW(Y=ɛ&a$͇pݟutsѶDOŖ %y JPmo+.Ŷ7>G.ץ{1zcU[b {:&֗QlsqR<.88TS7mVⷡ-KkٯfXqi~+,LbcVqfo/((f*rθQw'wy'qgj2QAA~i0L\%UK,P5++RPt?j6䡣e!u䡕5*4Cʬɋ,Z<ɋgi%"%wb-ϲ~3Q5ДEHqoOO *zB`pXUJ`X,E`>08 f `:0 ꀩ@-PL&$`"PT e@)Pc1h`0 @PC!?}@. r@7 ]@&^@ bbhX `L@$` @tCZqUc64ǁcQgOwap;7k+Kg'G_? ^^^^^^^^O''ǁc < v;G6A~>^n.N`+p;pp+p p3p \\4Ycsϱ9?csϱ9?c3 883 883 883 883 883 883 883 88?{cs}ϱ9>{cT{y21m\swdz"?MMeBma[ٽdO{9eu7`1m=r/ФjgzkZ-M̤*o=on=+}E^ڦp[#-V&IհZ_|#}<3asZ|u:rSP gOԚ b-|E([嗰eYVl[ք4jˁll$Bvۈv ]T]|%Wrv5õ:v=fv)4M6v;֌(5%Jgϳ]a{TeF~p>|3݈ڼsskt9ڵXy!jR/D/kNf́Q:m'[V[yf-'ԩ_׳[UxU;Iݮnw=xiJ2Yݏ ƶnfiO.Y`;$eYf3w6ۋ$ۇH=l=E 8^fW9^׮/"wV7pmf_(6oaǩH} ?Ʋ3+^lߵUXhfxry ao)݉}"6M|&5ѡ9x·~sr?}Ӟ=#ա _ZwOfF^>3|iQfݷ`5W:e"\}x:9BY˟OI9z%)>۠t{Aݓ !B M5(}#m4F'ǺQGG+9v1pR~'FQED4't:b-Ʈ3FCҹpRŮ$GE}5[|GukN2ح{X֯wZ|),2Z4C0AJUZ3Of>/#3Yy,v)>gYKϏ?'ȵȅdzUȲcc#4gjKۏ >5UOzLn^穦_RryHgMLvMҭgΉuGT%ly)Gcu!sQU6Um +eX1'{-p\.q$shwh-#\m*6˙ye(z?eՈ\57WU6Ul5n ?`ᖓP9o ܉U޶گ::5]Iot'zP bi N2F[P>Ũ n~FjR5U"/^qSY؅,Bv! ]Ùhjݷ0KbmairܑԸ=1B1*CaFՙU쇓8(_i^ ҇]Ybt2#"p^iRif^Q2&{zx4H^~LrT=*)<5SxjLᩙb2KSMvwD/_?XG322R8s9# ƪ?in_vөaKML-eu!IvrICĪzZɏtzqͭ7%ƄZ0D6|sd]ɺ“u' O%xVs^ϭ{my-㺴MFG91x<,zHGRxGd2mkX{1uOl:˰@."wwJ yxޚ"NOB\jQiUͮd+iVZq x#2=؜HksXNlǮ5 A>&mi۵%)]̑1ɮV`簍;2m6gؙlp3LS3{{-BJ/QRJMmF+Dspi //6uqVnՕh험Zfz$)b{ىədܷWx&Ɠ6ss9WI5_?mi.{T6Nyk}*Lڟ>pSxrS?z\vnJxCpHvn^&V;K?탶u_/XݺR={9sˏs_?Ρxhu/Gnm۞OkG/>ɳxa6|p_Z۹C 1աe|ꟛw S)*R&B"`==7ABT~LaWpa}' we.;Gw<Ί*N`p`d⑪g1{}wz|ӛ[ %KݹxƬqXjB13]ģ5,,Ѭ*U>G8+`WX+ kxT栟j$ 9p20lS 6*ZC ,ڼmm h$R5:9u:z%ٶy{Y䈙v`DzF630j ]sG۵ ,Y|pW%&B td6&Zfg P nU@\hmz&P!'>8a`¢vu튭iWX>FVII4 z PeGu!8rΒdŏqC)r/(Q숤^ jbWIN|+z W"1]ᐨNz) J_dKTVwH6tK4ڹF:C56lʼ .H,jU4Itj]k)77묙qY="ϭݜm[mEI'x(@dzqŨznҙ1n>ctjzp@kXQ9`VH'AvZ-xG=SZ@.?5'1jɋ.ϓwB4``u, G9k6ZepS?8L"^_Gұ\mlCrJF"5@O &I^-m*n̼/,%elu{pI\o}[?Db `F]ёF%V7Qh=NT:/SFhj[Qsngl~tgpmw7ff75T:ˮ "ykMo-vNu[ٹu.OУ&U ZpޖǻwtMLedSp6!Ti9S^c.g˒@nhU&8&KXͤs*a(3m"d&9YQˍQVVv##FpYdԢ~l7"&͊vl[R|n> -$MC 4h䠀fxC}ϋ;gX*Tv_ܲzԞ kDQ7/ǻJDNþp0 )#0:IZC/4b? }YCoj C(>R(|);% Uyx2$ɵu/M wY)LіMEAo{idw3笰Eb/gI"jD/O38(@jD:ۈF5"hDJaJZJaVJaVJ¬(5F]CC@71Ƚ┟T TQH9tVn3Jyc5]>Im!bt~+%JT{U:kh=GWxޞY*gAYW:Rgqkr0u*S|nK6~6UȳBܒjAYdW; N"mҊъ:|T~&" hڝz;o¸Hn,`#Y) gհ2\/|% UScҚ^SQ$mEBS_ `5%K۶.̄@[C1Xպ"ڽ j7Ŗ6I#Y;=6$߇!{5ĝ'YP98S,dl(9l6tgZ93tppG9u;aR]ތOD=MZvt-ԳAs}鶽]%\Gn3p4 v,?X)Z=Y&L eU<𘈯Nm2N{F ˗Z Ni}=<0.]I(PYϝhEMeXܔ@%P Toŕ W>K.nkk ,Vo g aޢ AY ȶIj裙\7nXKǍ<ss˒K@#\h3y\+˙_.ikEbo (f17 >fcTIdC_rQF%7s>WH|հ(Xln-v_^W^[~.Sr:Q.,ZDA4ȤoM׎^<+m(͑/jqE h|ޞyަEMA@b+r}J)nIΗ8k\oNN`.|E-u+ӛVU Ѻe,}W!\F,3\UXR#E`>wy3aNEKwꢑ[+uJފօ5:5ݟmYPk7kV?Vq^XrsG}ۆ*YO!b{/؝ z6_k-b^}jSsnmųKE=ݙD\ L y+#Xv"N"IED'="vfH^ z Wl1@U&bf۹p^|A opx{$i|Խ⭂[m0,C*<}6ibA%#Y-hއP1|kEFFQ%(3)^g¡q\p<|.b/c}Љc&CaEG%Ŝ66%񔫟 =<W =Y[R=f[v-ݲUdEƍ% ɝ(!!O*;@UxN9> WxUE']h|JyI(I=D9c@E VPn>Bǣ~ byKombX(C @,9tS} T?e~1JҠI&E(@RdmpƼޘH^TbE.UR+\6/Y^}{(FkZj^`),IذN^Cv)Bn"9C@ րBFPj D| Aq 45&М-!N*is~xΤ G46Css->$UgUhODk]U,8jd89r>9){2('/Ѫ,?7 ˺̽4S2b^_COL/PgWTBP"WIV4$DbieQMB>IJ'dV:B;YnkT^|EjhP;zEő=Fء',l*g Wo E#8 3RiՅ` պ̦(п "!\puH] v b( irGbZO;@!2 Yi(y"ڌdK]f5Y{*Sj/Qh[afT|UFH Zjnd(0^M^u ?8.I&D3L{WϳlKa^S%k = #mY1x1y 7UfŅJ4eݜjkF߷gotPx2(T&mSإߥ fh9BDl4Ѡc0[f,p&[ a`+&M e`8rܾyV#U^zp_yC4̺m/*4nD' gAGד\\~DMVN]ErB]*j }wpҋN1f(Mrnk;IǶ_uFE2l <%k,O/@9H#bv+@p\MbhhʈBޣl`7lZsfYPS2׏q|[2'D/q wsZ;`]tA6By#;%@h:Ppj+ɒO\|pކH_@tO&i&2cҮ1`9,/y#ޒYpwITz*PWOch/g76wYk:9<(U4 :V Վܿ0N9ۇe6<4-wSGVȏ6 /ֿko\š$'1[fMkXѴ#dߐLE<۳L@="`JV` aݘ2RWG|$<ڇGtwE@V>01!911 >*v5^T;oƍ6i@8~2p$7E\RuRrNxi=:Ň(>tHx-uLrܱtxIXKGސAu%•>˦P{)*[Qrn1Kζl;r˚onn lղL dV^*Tҳe a~ݦ--k7UVZߕ_T]9u*|v-M o׎..'WvF;[}ٻƿ]=uUx ^(KZqYrL rA$)a$IPF93Bfxft 7L/{S|ʧn_X7=WBPmalD5 yABnt96ǼZI4 kA+ +иPkGoP=WWGe}zgy΋sc@-}ɏ_QPu+eeĤ#g^,^JƢa%cG֠_T*֠/Pmұ vTt8sgszO(Z0  2F HxA܃4V܆$`ERlŖ8L C"^7%:9:u(74POZU1+rH ˘G_ŧOJCğf5^gԔ֤xC஛œ8$7/yjk[.Gjk5{m6.{UPSEEB#x-&+gegy. i1P^JM(H*P A,a;@ "1"&b@ R,RajӨ]]͍M\<78,2. )rȸpй(A2LCP, N1t"q<\ WJMJdͺ+3 \_TZ20)VoclZ5#z{EnρHwp"T.z6% @OMHB$cdփh),ɧdAW:' cp4b95[jP5V:KⳭ=%1D8=뫚Տja;xyI}p]o\i[cr(6ԓnjٴ gRᳯjmeφέὋZDvl՘Y(x}-G4g-MnNwZ߶<;ä)grb'n&&*~#9#yS9]~~eqrcwq6wPw'Gzŕ 2-XK]Vrݓ=a]0 6xJlVyzbXU1BΊOEYcE xu=*LXHF%!7rqf>-r ^x5d@Y+# ]TѴ@F~dܝ̆ Ȁ :*FJ{('6-cfkn^LA0KܿV·R9^T0L# R)a,ԼV}yɭrdoS #mM W!t]u^ʃKȺC+6=4Z; u_Xo_v41 yv9f'>idLi#|u_ۻC~[_ؔNYS׼+&m%RXeȋ>^CT XҔ̧TZ0=֠U][4nj) j!T-M%Oր=0I'àoR_Jod%鞖~@U IR&I%tL&mu=!ii %Oj= 'c'7 a8IQsutDoe;zz-,ѭ9"Ѓ34CMBwoPv9y(L7ߩ=o* 6; ~c Dj@#hBQ66L|5+`wa}9xS sW'$hj!aB}x'خv݇A On‰NyM|_Ch Sm 5i|vlgp߿ [p^nbE7O7 'ށ|7p¿މmllp|~x ~׫9! #x.:>ޙ3I5P #(eCTT~!`h L@W?ɟaf :FhV]6Rg?vjDDmED-beQ#"f,{ޙL[g}9ϜsϹysspg` Wۍ$Pc~'c> =ҙ(cxKL¸KuƯd0pfɰ]`F=B[zK@RXR N¶Wh(E!3SL!> e3c2n3]1 32ƍ{Bp ێ' `0`1F=0blaɇ@?:O{X#E XJ% h8 lǵ%`|=R  01pջbX2&0+y|1/[|/!RXg r^EG嘣·6~A_m(c8|-@[X>`+80C` %_m p`V`V%+F2N}c5G9}ߠ~K=q`m4nqhF6#`8 j|s1a |Occ=ICkȁwg>̅@ыb6~c7xe"#^N-]H?:3p,G_<`8­֏y!N$3˙rp9s9C/o5F8xc<l3~2pU>eu{i^&{i^M3i6ܦ4s6c ` ?6{6Qn6Qn6QnW&^xUl9sW&^xUt78 s I6(#8lfi6л?b#VC`cb(ۂ[[О`XK[ ?j^Ʊe+l> lú k ʭGqaHWiaX<84|2a870.<^F'KR`xU{(Jss=WC VJ{r0= k}.@k5smư>셆w#ꅆ?sR/u|G#z^` G;13cas" C_۸6f>{6scu0`&`ĸ]]5D/c`(p2c80`Tkj#ª@?B>`x>VK1{}l3*EB˘7R)FcEc`1 CLn@n,/`:A 0d%;KYyU\6v<]\ci5Ѭ.Nqj̼KVޭtg{V#.XLe-&K9ٍ++/mМG*F9?6vqVޑv^3]#S5Zy[yg]˭Ggd,q,6ų7y6&fژo1sl?ߜ4{AG05jMFaPsjylq%Ws,)+xV\Q͙>PpƨZ+ZcWC˵bX3+zY$7gjk]Si3ހvEeNM}mdHYÒ>5#FP{smR{G9k<睇eyH)F"qOM~X]5MPDlq(۰ (;2A;#V",m""Gv9I**r,^Y* #2W~)vY'9$_rlQyTn_.&cE+*SUYe+%GY*JUBOiW4e:_K˔jS ) 5딽jrT_/*Տ,ckj~^W窟?Yj3]Ν7psp<-wwp7偻Fpw +wun- wKMpw}&F].][][puNpzݛ-p.;U .wyn&ܭwsIBpw) wmnkwww?w?w/7>Xu%j8pwJ] ;=v߀}]plTljV&6%OFp7-wmw]n wwCKuJ?g@S/RC455lPoPQ{Z BNwwmp4K}0wù8?1.] nwKCQp]p wσ7pglMw3|pWփpܽmJS.w3BpU&pbn{= up;!{U!ߛNwWn!*wU5Mn 7p w~pg'lY綋llSf ni} ]fݭnw?w=Up%BL^ 悻n%Өgp0^w]*RUd2^*S_%+7mwp6Op7 .-U/qj٣Ε u uvp8BS_w^ww4ͫ~d~[ͯقNw1p yE.ܕp 6vp(NqwwApq]$P+(\!G Fy% \Np}p= ^wDzY6<U/ԫdZ,cbE-*(pܽ [l.u>Xb.MUKmjm-S#u֨:pL=nWO'ۯͲ¾#N Ѩ.ڡX `3tHjluӇtn6X׷u.R:mu8U#tƺݱX'i[Nt&h;ti EEtAzhzEdNXшt Η6>̋p-[SfZKU2lGP{1eX7|B f:-5N .puD 5NP"~T1ic{:lmpg؅tz>RRE8$†Y!Z:H:t]yY0)L eݼD'ͺYcX#xZ(y7 lͩ:\{ KT#_u˗O;3GѷCЌCM:]38_^~e.MOwD\Ly"X?U؄ x6WL*;/l_%+E9ltGE?Ꮞ!t|?ou  Gr#Mt.Q $ C.5IDa%QrIrKRM%MTM%5>I%\. !Y)w9I:Z\Jsy,s  Ofk@7r4Z%]ww4j]G"hYڽq{0t: \nqc( qӔG=!E!=δHғ>3C:'|ikIÞݘ{.lଈ[f tTrm۷=QT4`lwcxcAdg}K&锂bSFzsgrkGUк=R6“S*l+S&<$#gPJF(||s!ʣQ⡚t1Y[:Dx;|gK; D&7GٌSCNYT& cHU Yk,WWevlhqJ{0HLڵ+1qxD̠Y2%3͗@]u\v\tKCi&4ぢ|4.m&Cw#W  sm6ܻ,Or:{}tY''Ѳ?X!^%r$Q%nsuS z.I9Bb֨R&TV W\Gҏ.T_7vT:1:TJԕG[a;?wTG"$8yGB'.Yf8fK*zҎvY`~vn4?0v ۇgpx9kQm^ri^O;ztcM ? \U_+)on>[xS[AsJkf vfgv),7달/ $nod<|/MZ,r"kBJr!b,[N=Y۳{%i "lyoJN2jY$2}4y9MF?9Ŕr! lgQy ir/ g=~cSRle9\t ]e_J̫s٘ytc;<=%'z%ShĂ,8%KnoҼK'̻I/N~DrHp$) r/!ɔ×?wˏNM͚:z곐}y!ӶYU]32k_2IK2Ȍ3rf28ُZs ʏRuuGZtwssn(Y15>V7ͦv7-?a~./dc6`KːC .}sr2/|e+%/Rrx᱅_.Yv,cy{1D1rAoD [CN5.://M6qMU/_ef*oÄ`K0OrukWwow޽zo(^ ?~#2=2iiSgM'Sol~Ț5_k%Բ屖Zug/z^vڹkkwݿuV۲uם\_~mEm'mnٰcñtWĪǣFo#K7t'J?kIF4;ĐPt (zN\x/vuKv}{R1mGk3wfm&KV'٣л3=Dk i;vm9ʳ\Ud$|yﰻ8:i=4{K.='ֈcT&96=4WOILdGo~&ͫ <&Ll]?f @ӬP\i4+d.JiBw8ǿR&g;mXwܔyi2{9Kr:S$WYxqr:;GI3Kк7g/35yMLi}cYh3p)6크:vP3hdO9ΊPyr/̊DObHv,\K;}߁]a:C;n%mvz-&-<K|f_xU-{5ڡu9}Zsh;~Œ ߈Lrx`iiˬzȺXpO0zC}}G?:{ 62+Ĵ4ok=]}/EowtAsзTdA' xe24@4h-C mz4;ˮ7iH_Bq _CG,LoAtz@4xW l ˪!Ek:х^5h26bh3rh:DPݶ|^kx3i@\Ű5}׆bm+^B'ЍbzCX1< FcaR7z̰P07 V}8_yW5||gz WW.u_>T-^[)nW/a GUsqL`6 ^l .W*%U-r/w%δu,_~1zG4BaYYYYYGʴL+ʴL+ʴL+ʢXdLAdLJXMs4=%/dMVdeMVdeMVdeMVdeMVdeMVd9Yd.f\kYeUTSYdzE^z1Uc(ZhY*brEU?ŕno]郮J*NPBT3mi\GfKtXUo~Ѱ6EwlUL3~Vta#۷%:|~Ix{YSTӝҿK+>:#fl#mdl6F6flgrEΜ̋g9Ιuάsf3Y:g9Ι9gcgfqfƙgfqfƙgfy;<^$_5T KͅOS4>XXXX(wڊү~oJcE٣Qgwxމ#qƻp q8'Dw=8xޏTC0>9(N8q(]~{ ½Xk܏  `)o;7l\;AʟW*Vޏ ֫fs޷ʗ}!lz ފp ֪p08,tU o}UC.TɅ*Wk8^zOթ: LG%PA-2.A3]-jqWZ?q!8ӱU}2NTG/;W}5}l5@~C/ fLXgfcƞʡ3:Ө3:ӨSMLs4L4ʔSsw=>_,88z>Gx'Q818xqލd}x?>Sq>8gL| YO{ħi|gg9ϣ+W~ ⇸yˣ?Op+~p;@7s܃_b܇_ 8<0~%X v^;wx}wOK>g,V}bG+VKE5<_u Bǫ*t Bǫ*t Bǫ*tQo;K}>3Jc4J]򑰹xg(u?8+Vnj/׆5xQ%lWٮ۾0U}yrйY*cﭮ++3KgJ,0MU]v>aj_ojފp 2Uoq8X,[eveSQmuJDW3PZdP]+v=0+{ao}fcgqVgqV Cp(F8GٶR>w?'x8Nǽ? s? +?Oa_.yng Ww ]v\NՉs_ S3yƴ? zΨ{Drg7C۾}/,Uuռo hϼG)FggNkJml$zg]!:'8=tSYVg V.לVלCp~qngw?)np'wg?=~_^,;B>Ji!ugK/acͅ&..%bKĖ-["Dl%bKĖ-["Dl%bKĖ-["Dl%bKĖ-=3l>0?az8BcXU? R_KS_pCXN/\? ؗ}ؗ}ؗ}y͕aiU>aq-7ƵܸrZn\ˍkyt9hlh4)4)&Hz7}&-1qhKwBvMʮI5^5^5^4r3iL#g9șF4r3iL#g9șF4r3iL#g9șF4r3iL#g)K^ R@/z9} ThThӣ~ƝGPa/*Gpo?ϫy<ԘKԘKԘKhF5@j4P hF5@j4P hF5@j4P hF5@j4Pc.5Rc.5Rc.5Rc.5R! "Έ"\3Ex M7m03}zWW-nw[mmmmj1n2:2I=4sq7FnqMX]Wո?@qZVokZVokZV_kZ}V_kZ}qAW5S95[90U9S9S9cO=1cO=1cO=1cO=1cO=1cO=1cO=1cO=1c/s:j@YcEM>kx9߱ՎU)5"=JԈCq5Q6Y͢le(E,fQ6Y͢le(E,fQ6Y͢le(E,fQ6Y͢le(E,fQ6G'7x*ϟU" خ "V${ff73"mVnVnVITMjUD$&Q5ITMjUD$&Q5ITMjUD$&Q5ITMjUD$&Q5ISwŝiQjԏFmoXĵmiOx&2u_/SWWRʋh7H] 4=:ԕ2*\REթ}SJ^jjmm[VQ\k:q!o[...W*|/ZgAlN4lMyҋM]"/e^)ʫpMhOF{ :˩'{6^MQ*TcjP vn3faO셽~Fi8JQp4hɡA|G08_*&m\\2\+p%Q@ŗ1u{K׆ y2\(r`JьS0QrE3L S003L S~E_~E_~E_~E_~E_~E_~;;;;,W0r\,W0r\E[nE[nE[nE[nE[nE[TsR-ΣղhjP{FӸ-2}ȑh=@l Κ̏e~,c>·>aHA}t >HA}t >HA}t`m)p9 efflbGjYWi+ga~jex :# SC{ZLH{㯕?\W7ClXñŮϨgCgjL+s!ZIݺvc(V5nJh ;x: /P}=DŽmcqN)aS!ę B[#2zqf=!}^ kL̘*3 }~}z_ۋ3XgtG۰-; }G(K> Qp#FP/%K(P*&(5A JMPjR&(ճS>JP*TBRASo)"_Я%!|M]Ϧ&˳aE2ܒ΄d{WzVO}5}h?(}T s]ӧ// Ӎ/Ozfg2_w̹ð&WܪNQKDǞ* |ޙ-glYC3;g==멺\#m68e\Efm+Bf=U2fȪN.a,;6ˌ2c(+6ʊmb(#2bL(ʄL̹͜ƵRv1J#_~8Vt]O\Pp ןp̝ 3U8k/qƦR[ ?,˳lC)i!= =_M as8%vPb+ P"Pbrg]MRb2bLjOŲ齸7!84lIχH=Vc7@IN OR8P8*̣tBJ,B7@Ao@ P}wPk')6/D'Z'¥^_@`W{¥uQKU}.ԡjp;n"KZ9!7q8uuu_W鯫U(yYǜUGQzԸ'>)Iq{Lcb2-z˸2.qc41b\+Ƨոp;s'II2¬V{ewʭpYj]sY_!\ kȖT-eވQl 0F]չ{Ug5W}^O5!Rmӽԧjtr?n31+"[Oͭץ Wgl}>] CӇ~np;qd%e pm˛':$; 'pM^߇VOpο]BH>E7ОWUɫ*'*UY@,% 2 |npSWf܂;qEusoe~{8\/\a6&, sT352p \`}pY2 'b +_庭 a ]k{ۋu>-9 *wY{ꝓOf`oMTS*v@UvVU*|I}DeQ17T̠*M Zd}/KeՃF3#fez{ϘيЭ{vY#fe6{-3{-ӿs԰ыVu~Iduoճ;Nd/ KUTicZN{AXf[f[k[6Gl|P}A3̵!nM[Wջll߭wfji_"ϗaISS:<]!/r\k&In ˭ayI^mW+Erjnz -?ˏa IyЂV?Rz١C.|P7_2U۩.'so*z=eWQv"7^э_ҍ_ҍ_##Sl.'WɓڦmrK7]/:b7S}37:`ءvݬuz:]֫b}X.֦`::lnNӝt>ݩOwjӝt6iԧ+JmQnԫĝU:ze=VqhAw٠l-u:za=9Ωv]aSjW9Jwߡ;T|PmM>ާT{j_vU^WUzCVǥuUVzZg<_lfՒ_t)O*(b>/櫀"?,_$E/ˋ(Ey;ilNՀN>iO3}dvټF4jR[dv17p{DVNd"٘Dftیڌnѵ6#fDF4lDFhͰ MQe)qus; Ѱnn[[nń&pĝss-&=qssvw/=<#l/E;OzqG-=q+5*0>':>Y[gW:Nyք]jך6qP"tkJTa;Ɔ3ΚEJcs|GM֟ߟMT5OhL :n:7od s-slzzﱯ=Ṃ7nLƴŘgVj[c1luqwq[wmq-}cKt?!|՛l'SUk)Ý^}c/z}D]p'e)uzǕa^KncǘQEYll]׳;Ew|/F5 <tSTzM43Rn^Wu7Sz-b[7ݜl*WErM|O^1n1nj5X5XV?t^.qQ7p=fS=KlۈD5gxĈKP;KQTR9K,TR8N#R7K,uͪDa=2, OE)+Qjdq[QQ0EQQ3唙rL9;¼5˘u|ь7tSf).o^&/ݦnSf)uw6ef5=F4Sf)T4\H~f5gu(2l?b ;*Nx扎qިu6N;b)g KSbz:!/}+mU~R,G~yMO|uE!:MlRdс }{'s%Gr{i7~9&mߞ{l,?Ӷsyz4MItHλYQQQcz̘Vb4lTvmN[F9Þ#gz,udi3l3l\Y [ [ [ [ [ cV2V1ŰŰŰpTe4smXtmV`n۠13u,8t)4:,4Ao}ͶJovv/_7'qgE[uVEG876Ep@L( (B$¸+[ha&Tn|:3ߜOcUݺ7G՞b2Ϭ3kT>3O)T>3ό3F>l3F>3L3 B>,*311Pk5Gçj|_j@M6"-&JپjCePپP *C+ )VM6BKHStP̻9Qm3&UOmCjzoj zILX <Y'B+ ;956[>0hm?84PnTVГG>u)l>_}(r *B}h 4CwC'+GcccC+b( 'a8dlvs69ݜn6ƪ-8/`2L0 X@He|>ȃo \AO&X*Ae y0vGقkK7qzAΙΙΙe2^񲃲s#&mb Li0fX ,/K -vCj56a56a56s=pE;;;;8' 'N  [NqbJj [`q-κY8Vu/Е<ݠZi= Op /Y̑Y̑qVZr]u%=ޟ=ޟ=ޟ=ޟ=_ >OgYQJ< 0^`,VT`E3X Vt+͊f٬h6+- }QeYjŪfisNm.̃"x^:, o2Xo[V*xVCvME)H[pM;T~zBo x41HSihnk+{rCvMvQ^zw0?BXkX dHȂQ0sx8w|g~g~g~g~g~c>c>c>c>E$?8>r+'(~쑊X37/?8ZJ|R"( "( "( ++((J ((J ((V/V/VxTy a<a 'T?,@,@,@,@,@i*4k5MŚbM5u:XSk`M݇݇݇݇݇݇'Ȇ7`z_=z_aaacIJD$)ചe_e_e_e_e_UUUUUh0>h0>h0>h0>h0>h0>h0>h0>h0>h0>-NW9*' Bx(' Bx(' Bx(' Bx(' Bx(' Bx(' KKl @,Xbbbbbb+h_*sb*oTj4ެެC›uSzwWU5?5?DzKWM"I~J<8=WTErR&|x:Ϙ~3Dx9/\sr.^˹x9/\t%EIGQQt%EIGQQt%EIGQQtԘOxT)\$>)6%qo\sQ|.E(>\sQ|.E(>\sQ|.E3WALP7k=D{G{H &7k}O';[e'N-T{yP}6,/p,O QUFNs,jRi-176Z?uzV:VҚV jbw|nXnVh9Z cފ'ҺYrZ,'"yCj QjڋWC.WзOs g;SȽwGN')1'َMm*z{\XEj_</?_NoqC 08;wpޝaLI@)0t3ă90+0,VwH-: 2{`4<O3,< 0^`,2L0 TāY0[6V$=a+Var\, 5WdHȂQpQE#s#~=g#~=g#~=g#~=g#~=g#~=g#~=g#~=g#~=g#~=g/)\'SU@Z@Z@Z@Z@:8tqg.qg.qgXOyuoƋ͕[E e>l<1\bps S)B!ftvmA GпCz_=пCz_=ЫF-RS/jЛz_EBcBS)s,u`yu XԄIM:^M::N7Ah!?5#fQ_n>-eeH4g޿A9TG$h^^'ۨe7rOMwQEi5,]HҟfiNp9<--(>6JRtKo[>ĿਸU0XE}-V#5zM'3$7 MXSOi"%>!RL?8DEztvcH10xȀL Y0 Fbbbbbbb_Qgh)Qﳒo3P=؇0'Fr1Zem]4efz0]Mt=1MJ$rh)ghcdV7F+є&S:`5t*~`|*SA!mj}|1v RRoB!w29'GB,aEPi0-tEwꥰXθ"UľŴY'jlITgDş V+d;mǴ nvƿҮRc5F?}W2bYgR% fLI?=6)yŔ җX|(Yĩ8$n\dg_"(\;AStbgzMd_d?̌oV١^IR8sr.u1P ݠö́Ő8*$ s-"cH1¸fc=&w҉]Q0%P0%P.M&vUD/PpT(]i;מ\bZXBlee,ېFE%I)d:s%q6⟆,`W=;J %[>SΡvuDDeG}'G V3ٕ~xC쒣1t2J-'EE_iN4H8 aԛT@ajPsD>bE9Ab3G'WX"+Ed)淪ԢSK#XZSKZ4oSÁѿ"WD_+EH\+vax2DȄD*-kY>f6,wf-eW3٧Odd%9Qb2Z@ aH|\ oEZBhgxչ}=V<%~/)ɕ\+~{l Hm&C'(}9Hmm/3*UuvEi"(5@ފ{QS'cB37PWsĶg*Bcu|z%DXDĺ7փ1{o?V-Nnb^+#>cGynbnk\'1CyW)˽ϞLr’^'8/DݽAۺkP5?'n _ g_$?3 wMª7b'8հjX!V/8Ī2|X^XjX?VUEL}j5jsȵHCfQf$^5cV1+u _M\ xM:KzϮ\)2>E9nynT J%[hCܤiq߸&rEWPTq"W;v'R|Z'H~ZAJ%_+hELHߦG4I}-wxTw bx\x KLa~<5UժZuZڋCZG^qDu'ZOii}D kCY6*<~j-Ӯ>жj5zsBAk[i-[zv~~v~VYo{?]TM]kw}Z[>@kևiՇcD}gkC0=GX{NTߥ!m~B?ڻi~Q/6J CKm jR,/kdmWZ.YG²lE5Z-O6Mod3\˗-dKl%oҎl#h'V-*SevRyʮvFt-&'u!Gʑ)GQ%gș-W#ߑF]VnփrܭWI<'~3Fyhm;C1}Xz=c>تb0 9>G\k_i_Y}/׷GþCCz慨wwBw~wwZ?;;]]O|Ezӧ2-3I?g6K1YAWf%1`A^e`.βli>g /dOs9Q͜lNt9Ӝ'1 eL7_7_f|| 'Yss|m3bF4sn3rY,ZR˲jeV=uZZm62lٺ]:V'4l``%sjJ9-X=Xǜg6>o. ||=898\a6Wo_ .2W_ .5$II憤Iϓ&]enM:t!t.{kEQS~:uHMq^1GLU+-Tcy[u/y\Es(Ugwf3aRBr_!"UĽ'.<yJ+O}M uFIUX)y:OBF .g>[j3(o_W RQϣUO]-jC~W|/BN UC<8z ~Q:>QA/gޯ~c*qI %)u(I9O3{R$`ٺ:X?Eu38&~]/A?{ODv~-n&T>}y߳xwfdݻz~Gyz'aQo$/UCZs_\ӿW]tU;ҫGG/2U>n_և&Z[4 %%׭ͮXdv%gNgS;,X~LwDIW~_t<|_)$4,9e\nj7scx[&Ս!n[wB{qT۵Pgc۠0F2ngMd( `acL1:xC?7z.k c9k Kzfvn55C#ì###GU% D:J13 b2c 34\'[ƓG?12U#F /i Zڄcl3\-J?߃#:tug:B(FdTH-#RcDqe\a\jZGjH&f2^Sd&x"5YkG&?%`*D,TcA?>%~)}F0ȘNŘ^KokRo|[m{^JGѾTwZ2SeOџ%8Nt:;t`x芒nN7\\Dss1%8N8遶h3 rz㘉1sr:(zN.X9b(2p݀VCBԹH9#[[8҂8nG;;P^~1{OA8}y% h)'LCtrflԜE<}y|e|38c?: ἁ.=C|`L:++g=t68lqa[۝Tىo;guww;{{s|{rtC!|9L~9Wu-Je4A M&@D "h4!hrXw,)1BrbQbY \\E=(C& %e6SޢPZM!z+n(Qo۩ޡC~ޅQgލ:?߫dOC>LA}T{bi Mq@1U CAԡUţ$!Tݨ*-1%TuB5(!T3T FN E؇r`J MVByVh6|:7hH&!0R 4?SNA )8hG~:a F`IM@WS߻`jIɂڈ6)d1 5 #qJ^JJPQ2((LLP;NWG1}}.3@fU7;Rj(ϕSkͫ)  K.0Y[8z;:sq>`\7LA7[-tG \\˹5|nUn@@īQZZ`DF:W.A \g3mG9PJcܝ]3ҹt ]GP¨ Mt&K3|Γ@=3zO9O!?ÙDD}ASp0.pp!a[ ;K\`jU UKKKΏΏhWU/Q/9}q`v 3V#=p;bQ`S00&0%! N >NJ'A?='#Ȓdُ3ES8gL !&E $AgU UCƎPj(5"Q =0v vv v;DCjVhj j(RwVߜE],6o;Ȼ ]|GU-|KmJ\Q;Y]mV>--v{> -WA9Kn כY;[\nu-fsIOv+O)/o+}'ol&7r֊gry^/eFv'qڟyKI%FΚ>:D>Ka|}&i*U'!|LXR==_a+ֽޭ߼iPvO{=/c3oo;z+*WqNu{d"~[ y;Q׌[{W0Vxw{|\=Zﵥڣ^7y'9ƛ 8 3/X|UʐkηyC,|?4'`* ~.}R_#ȶ /z #wDFqoZ+Ocg-r wTCC=\& YS~ &)G(yxL 3E޿Ri)w>[<9ury( EH^o-GI# 5߯,/d-WΊ^UԓZSs'ke^~)y7x/{wq=`7 䍋Pͻd ֣'_WEYH''sLrGM2OV;*ǮONPFFnwN7c Kq14h!NG؝iR-Q*;-Wssv/ԅTMZݦF5A=Jl56yY-Pҷu:}7iZޥԇCQG-jj9P+ f1ff9aa2u G\q YfW(qW87W f3רf$M͸ތAVk $z{3 5F{3`7ތb{3Fߛquȸ=ތ͘otx3b7c6{sx=ތXj5V2MMYvwS=KEc_7Ͼn::ګT#vtS簣jcoU:TvtSCMT\J\uh7՝nru&{T7Uuk츦`55n3z}D]SzmvPwM=ξkj*'wMMg55VwM=pGg}M=kjj;^pv'쾦^d5}M侩o wZ~~ֹkݭjQdW6]gveSٕMaW6'foon4k[ۚ9f}''3ylln 5nfve6̑fa6`\~j|kGGOJ_gf6(|sا`6_}|UاW}|>m&zKg6_&ڰO\ig6_i]>m滔}|Fׇ]|}e׏]|ewn`5_~r}âtT樸m=j~_q4ER&^_4ŐA3)1w[롼>jYХtxؖ4C;Q@+Ъ7bc5`7#ۨ _UEr 6)Q,O1ܳ PhHF#1ʛMO' 7wGD,~IF?rs-wȸ2Xy?:H0eǨ1 LPv3A svg|57>lyg"ۂ1J0=F0=A0<[ W?G55R\wk  _O`}`}]T`k"~OOܯT  7oOfDMd3:LtЪksvf;܀%||Lu%7w-&P$:77}Qt ;%^d(RsvLW(< X1b.dZ_X_PMkJY/¬%k(Yg#Zo'`m*Fk#yNIFvk;af kns%Z}ccX??[?#:!XGQ[Qm>jg[Ef80Y.lh;hɴ)!ʱ(,ݎG &IlP]NEivj-vmPǮu_nFTnl7Fy t;llͰ3[34m iqVv+۠f[-zȶۓew;f 9\=?{gV jP-lB[m=EU۱w,%h3DwwQо۾[ǾuV(e?FOOQs u˱_`W+,{Z٫Uh Vuy[6{k??>{~0%11!䣜XtxJqj$:թԤf`9 (i4 Nj;(99r '=4sfs9pZ`mntt8mN[v6S`D͙3!3!3!3!3!3!3!3Q2s&Ja΄Dg1gB3Q{RSP:`N`N̉Z9A T@n{#E-XPs;q {'?`T0e h^E-&dQNq@o߰ggBfZ(Ӣ3-D0-D0-D0-t݃~(Yu~Q ]jB?G!F1c1ǡ$OWWU5'(ӟO)c+TMyp; """"""""""ѹvQLWف#E {z#e%0C}٤OGy?C &yuػY )f`W(U}QS sPm҃P:P}Cu>0)Ѕ3\ڛJP~xHSu]GS-=F߉wPn}8V?! L:d=< ԟ"~}NӰvN S)j̕Φ&i4u琟\=k_/ t~k_/c5j_ Q~%່່P=ouQ}~5?`+OQT/C`^RB+]נzzKވ6MԀ2+ICwڡ{BRzxz0 J M&GCR'(tӔ|iDiDiJ`>M "|Z R8JqQŒ/fUq0㋄Wf\Mq0r=c%=ĿXc%=cOXstxX{.C{ԃ!#$=ZF2843`ݩpˌˍx[c1 ff[Qw#K9#3#oF>ڃO`/#bB[X,w,IX{08aIλ/w' /.k7# av&gY\0vg;­/nUup닄[Wn]Mup$aIx{<8`̞cζ'ٓPΌ04{x$s,{&rp93`)’/~clV̒%_ھ"\pb.3W",aɝe`’;K#,’[kX8̌[;(a~ZqǗG`̌WC9q{ZN=(̸0ŒAxpo8V̀; 뜋>Q,Z,hqE, .b%.b鉭%^b"M\E%XY"f%.b"_E,Z\"-.b"fXY\,q1K\E,Y\,qr.bEXq?*fXHâ?,0Kâ?0Kâ? ?ŋvu,auK?G90KÒ?̂6P,蓎nAC!~ vݳ7MQfDtKmAEdYnkD0ܶn[=zȽu.q/nw( kYϴws\@w ZYtm‰rotܛff:Ͻս%En >6mRĹ1KN"΢s\,Q89tw:JfuV;DvskQw>KP>AwkhhEtt{3k6!>khDt͓-j'KNQ;YN6N,Iyp:CT OD$(֢mRDti4 Bd"f @Ea#z z z9WDV:((:p5 A8,0 0P8"0bŋ.V誈]/XQ>hK)tNkRj&8zSOԎ Tk&akaj0u-D4b)@Pp%U()%P)O>i"8<HTJ~Y4яIX;I='aeRGIS=C@g!2eS?e y]ϣ Q&De eJ^֯Yz^Ql~SL2Dd&?c'z YrdMԫQ4I hmI( AovY4}rެ0]Hz'J)ޥw#~/_`m !~i>ށ` X P|k7i 7ix Ot&m EC(a2X#JZL5Pjjc-;8X74$4j%6FC}Phcj!'tcO M Q_-B yv./΅\.΅ Ź8HS}4ȯ6z} B4鶲Wp^F4iTH"Czi!H!} i:R?DHR"@~n}HT3y5=W^H6:5ff3@o+Q1?"w>K3/@ZHK>GZr ;PnQ>R RU꿼76RÓ~Uc:[g4[W6%WL2Dž#*9\O[>e"嵬pj(o%2nEt/EK]@mq\AℂDIiS ",h\[lAF(ZgEk+Ȓ]c^[r]=}6 XXpAѦp>,6K$B|OI>  *`h6nU2 :+5`Kp!.(.%#r}#Wp7q%r橂 'IuB*P,br<Ě/V%,,?lŔ[5bcɽ!.XsIpy$ΟX0Jqb^eeSD./Mu-X'q b_Qonā+8\)y# ݒi**+5.L(\R2;M⌼{ %,syɜ/|w_P7e)vB]qNaWHoq6-Y{Q⎹=) oAp`ɢw + /퟿Dae GaOWޒe{{_]Gx)FNC\5r6⺑sp{F]e{Fo}}Tٕ+! 5M4M MMBqBM C!RUJT*%!LC{:>q8^C^xC<BXa aXC'G?sիWVtuMa;o[ ڽMEc>輣h,*fߩ0; ov\L N|ֹٹӹӀ*%ssrp~HVܖr*O\a!NQ,DI6x=Y\@9(SwlC%h<J `nR!S )C8j8?WtL}M@dEjÈs+, Ǣi7~W(U,ڶXg;lO|Z]0Kз퉾laؗS% eq@C}^9jߚ.O8K퍾4]pAѷ?k? cP j(!g%2/SW)L@+'6=IZW#Lr7^#mk޷\_|hWj/_an w[I]$gE$7Dm/Ǡ'ZC}W]rt:a+iC}0վa̶?`{uWu_X $_N|:k0TNcSF5ᑯP/f6lub?$,+C|?eQt5a/~ܠJ!(6)K b J|0$Jȃ6Ee_gʁᒨ0x~' _Fq3xLsN3%_8kx>or]I UtVweDr}\]W2>ٕ!UmNW1 X;U֣RY$_1̊~pO)Ͱ,Neê8ӽdg{~/Y2{?`8WJZq?L'{[uRI';TtC~‘әdX{#d9:ߑEpA8J7rGy<(*G.]ųhzvL6O:a/&H ɿNK8pL(.G(;NAJF:8 x1Qƣw@bG{4y՞x".ٮv\ޥ/;n$#79ǭyqs97& -ǦM9v ؇,8HjnOWĞTzMJɠ70{) ٗrbP*cpI=LTSEO%"UCzOMt.?M[StY&Kj^gr[Lֽ#9.ёHЍWI{pzR3NXٺev tCPF]P 7ܥճ]P:wk ōu nBeu.>5(DץP75:*9r{]3 nk6TLqCuܒg"=ZֻVa޵qoumڸݮ=H?:WyWބO&d>՛P zs`=wy||\Cޒ - ުY[XqAo+͡ }yφ| WZϫ?ze z;|SvO+A-^Ohyς]Yo(y)eE M|h2ދr6sBw!US:4O>{_0Ȟ:?%Fh\"{Kqohމw >IIؽDZu2;NL⧼ ~v=xW;֓aw Flֻ x#cO_'er_B>lt{̓a1N #;G?aȓAwrϪNvg)քPM[ B[ʔ5TfvW@ɜjŨCw .سPژ,i=I4y|o1#/s˽W0_ޛe,oK.mxOg,o;Ǎ\oA^0aIp,?ֲ`> ZoQ/o;Im3 a/MЂd-앍K ﳌW\ow%CA)Wz+ pĕ{ nj]WTƋ eWEDا{']u77\\'zzʈ\\yq%.xWe\s|MWr-0>) ! x‘]7nBq5x84&zLjdo)u3LA)u7oJw+C,y$xm\`0w= fJ]ݙ\g٬t%}iΪLPgm_gc_~xo>Wd>WrUS#'"'Or2`b׌}}KO"1xɷ`| rb&LƝNOS> ϵЫ6~K!RSWQH:ҠTϫDK+*MzIzU};՘/cǾҎ(Oe$'d&2ZQ}B{Bz» ?A;  [ {>/ Ez 5Q3ң } Q ' t O~OHBQIߛ^Z(#NGST 5B}_Q_~)Y-KWNu[W]ʯowG7?N 5꿧%cN}[^VuNk ߪ-:ⱗLc??vH]dS 75oRj j>)~~JTkVi4_Ѵ4hhUՈLS>fP͐곚jT Uf\󏪯j4s*f^5K%UfEj~PuT=hvU!͞Pb_P껱ƾ؜O~>WM:bO6c&obc{.ŎǼ_՘Wc;;Ә >PLN?.}SyKic~ߩr<GkʫՂ^_ϛjtxԬ~>T7 )?/~..?U'ߪ}ďej][U*5p|p~Oщ(}TS}Q﫾׮~bT?V#ojT?S iɗ`ϩ~Z@qx _~{/~5fiR Cb4(|9,&5&7E_ɍE"_eĔŔL 11GY䫘lGT9m.7疸:rx>OSf||_|xyw ! %zS4?/}${Ue>& dk5rsVkͷYKX˭UZ@, V=m5AYJVo YOA9yE?ȘĠt5Aoc($}DJACe qyT"oEW%6$;4z@IKG(Ei`Eo| 0h$  _AяA> K7쏢E(O|/ G)@;7}'!ȧ(Sq`J/˩ u9 gXEg A)=G_&ב;ߦxGTՁB9)5PT5 `=u }7םm`I'Q;5EM!5M dEf_@.yWĕp\W5p\+LIs!wsA.sW w mr;>wj>OSt> |)_R 6-y/=?f'6+oA^$,O$,edWSS _#,O', ,0ay&ayaل!,!,h$pc \/$\$? \Wb~;CT306W6 nX>k%EZꯩ9]Gx7Rskگ&m}Mk֚ډxeoVEjA@A[q%q{1wO+)(.XJe {%V|CmŠӸo|{Jz>ʷG/1%^Y-kILڧ>i^xO-3DmmY]e~}"V-_jY/ }h_7-6V1hٵ}1#V*Q&WoD=/&pIbj\~j ȓ 1hOhX%OhXRjg^lgEl}Bq?#cENjT{ߑBʉ-z8E?)G:CDӎ,n@5q֚⸀515qŚ>ZĶn=Rmk.1Z縏m'hczXҎ-űk9Ye %>% ~2Ϭ?qC=A KֳR;G9:kħD}n R*iۘgR~{瑾]qu|xiXօ2Ws=cɳ@v+QUM#}f7>+?Um0?޵Oa%~fXlu^#BTL~XJeuҺ%Xwz0%x:HjԂmtd]DA.nA= `"k-|>ZWG%~M!Ib t?.MȐD![rv y"JAbqB4 IC?v ;]DL=>Qc#T֋Wqi;1j#Pԃk0B6!߶Mw7kn$lpϙ`-ߏ/6/?$14a\i*Ħal-m]ۺHl[.duil\vJk\xW"܋cHDbhԁٓ\^vv8l=L4Db\쩮<3\Iy3Y'7{18 }:~Ohd\bQ}:h 6}c3{=+w=cᶒ{qȘ<` -ҙg֕N:VxEr(c^ nS2x4# I$}F'>ބQiᒴJyM~&=Gdb5TY6²3ha$fÙ#l;=g=Q{,C,'u:H?#;Ά4gsGۢ#i(r %N ?}r=uȞ|aGTGtGsWy伈 *:.w9our1 Qq91\ a?q{EJeYU&a0ם; >;cNX;)+rzǚձ)vx|;Ďʥצ+0lqr-Qȍt -Knʴ@͵mRY&V!{mrV'q5(HA\vByHPBoPM{gҘL&gIT1L`3J}F`$s9͌0癋ej sta昄&<`#¬1j6MdSt6e l)[V3@:=1ڰ4kamPN&--%52pK&o K4LA_!)Ȅ,Uăiiih&9 }ANCiGi44~Џ|Xś|OObK+@Jə蟓3ϒ3ϑ3 r&yr&*@UL-r&ZMDHDkșșh-929)zL~~6J!KGԏP 9:99mWt_ԫ'?B4ĪտB&X{0r#=dž%Cúa d^CIt*AyZݴ! }/D<.ˈTZF1#I"njQ \Q{0W4+C9`G pyxrN&a6$>a$ ƀO  x ax_#N?32gR0ǯ"lҡ}fԆr)f4r:Ofd ș'RQbmc~ɐo(4G1EiCC}XS&C}rz>ohсX7Q/ }6( n0 7ܑ>axɒ!z4(wEΦ}t]3DDDf~qCDfS;+ V)mnbK2bkG"+DEϳDoXbpKJihfS"x81,gĨ2; v$&&J;hr]4Z3s'h6<(Io>t\É3yk'C">:/5>>^;&/9>+>7 wG48,/_%VCM{6SH+/~ ~(^?)},s時@;db7NKM$~\(lѡGLZ?GA6׋ \г VЯ``AvA~Aϼ,y0T=&>y薂 L)xूyC8MfyBuI""joP/A/aWEQLޫНz2+-KP[oG1^4̧b{\w5_SocO tͻ_D Z"Zh%hEQVf}\,q_෤B.A{|U~Qؑ(˺@u Ҥ,B[)n&R.Km'gT%(S%7)ܽVok‘%7&Njϫ>P˷}OsJP{FMntQL2Yg Z"RtSj썑oF1c'GZtZk=O~?'ds/l}aߝYB;wٷ"1IȞ=("O$ߗuݬ3a&EF_5yQcKh#?լ"xںh]k']MM#'Et$AE~.ҩ% OsݿʧߤȓsefY+t0>[wsCz3M6Lb%Mxc"<&s[ckgQ?2Ɵѽ^o-zKVc&_.f5a(|qɗ<|Q>:NeSԪ?O{/\2ε%`%4]|9OfKyZ}U]Q'-Y";ϟ"\t>_4q9S\uNW ^o#&>M/q)yPw߻\X&EZYoQ٣9BqI}Xho[׏ʝ.:QiL!E O<)gBKM>8ս0Fh_;{B)zGe2g@59&{@!>#o3h,Y,Q1/khgryLΈ194y,&簘br~ &br(&{Dlܭ灘br~΍y Vj:br5=JZddmzkocozV4w'֦@RPSBBz&%GGBrB %4Vh3Bӄf /TBKʄm"ShPP~\O_$;F\G߷!PPo&5݅1'w]PIkK tP/O 0vG *,4]h\BZ5˄Vszj$Mh>?ɇ*_4~w9M} }=t1|{MyBue ._HIpp,/<0·  OO O ?~)I͐!Y7CnD___ej=ZmhI^۲ve: CJy:p]nnn^E$&>@sNYʬ.cl+av(3pBwPP4m <\z$@Fh|@PY,,^Mu~ 8P#Xu9|[oolGfo7uoCݛ[#o<AN[E^;JNE炋yY=n%}mۙ8 :b_ZPz/bNGU@{) PU$Q7 }kWГN{tt:!Or-~߹M}tBSqtZt.nvE'K)ްVnSnk|Wp;Lp-p (hps`Jw+|g`g R f_+m^OP W\秢q/i[sJwG"JUwDN*F!Tjߪh/3A:Gp)XIvf|PɁ ,h ${A2̻KU0辠Q?/_.%%`X vv"OPwKT Ssc'rkG͂'#l  Qp5ur㈁5HP*,T(=/Y!h3ܵf nW$M)/ֶ3A$V'e,R+ I4VwZ\ 2KeL|by 8կbj`!8\>۰ ~>6ϻZ=&tef G-=AUiSocf!Yi n!=5|g䢓t VC q ^E6^7Ӓ!`e bJR{ToR'[}-Sk}.&N2Z.ֺ"z =͜-emdMd~*ɧk迆0!jE3_<׃_?{tw` #^ @+ꤞ:Iw,U>Gy߈܎$]K}xDܦn3b/Y%2w)σ* Vu:vթZWƱϵWv/-{Y%x-kNj-"?~DJ*tK; =84Tpw޳޺˰rQZYZPzQnm\Gogn#{b*=M|~-|:c9'%8!Czz+|#bstٷޤh;">h j9>?x0x[' 3 [(9'O尓`oߣt=N[+#up;BwZ?T޹ ;d_+b%OU=1jO2[:rv n`8r N6Rh:9V?=[;w.'OzQXG2vnf~(Qwm@Oe; ?Bab[f௱9cd j} crQSiT=;f?utҟ3 Cp% 0Ks9sfQ9bg;;;~JB$̩U)J_ϜlieAQKZ^D^$ἁOv,===/Pvsմ5XX6: ҷ9ؙCXPIXYڇͬVq6Wme5@5$}cn=]`)uݩ gfGqy%NBu-rY su ԫ^ z8Sv3;nq: Q~b=9/їK0|_6GޗE)&]!΂g'ct.շ~`[E'] 6HѝN["U5Di#]I[]9]=fRDn\ˮ^'\Nكq>)N5Y??Ap ({Gǀɮ؃~7|~)XZ7/0f]cAs#h/,›h*TI8> BN8vN iJK[hEK$:CXǥ` X5&z3܆RrsAN c ~KRc+gIz/>?RݕShg`XғWy 577}_|,5(]d=k+4>2{PGή-9O&%b'9}~88,n^9;y]A]0ugK~l CG\sEAYN)x^떰hAnzcu]=q'#̂An۫xCb3i唚,M |r:"1?j)#NEg>g]NF@f`+f^c۫= aR WK ,SL^k,$d?p)bfvl/+X 8OI2켣}sxNp#=twG Nu%Z o ,-.Kg `Hv:]#;+<97yucO,+H%^\/sSIuCw9I7b,sʹM%~oQ}kgoF;wj}bY#뺇I=۔4{rKjN覥I=Yj|\G^Zs#ߏ |>sθ\:"bnf{_KϚ:]۫ǪduROn&LOPz9#ka6CKǀE~Zf!EW/w9FIo0ҏk tΕzGyl[nmɏ4F"/Z_qBx]n‘30u3ږ}Za^^֟Lj~ w'+Aʝ^"r'ֻSxڃ?uU.w}~FDB~]&v(Eg̩+ʻ#ݑJyJ#AmBo-=nXО HO a-g.\wv{6Q}XGrzK5YP+[wWQz.F%egfxgKUSkܭ?irzx?< Et^IQ|ѹA>gGQ/ZKӐtq&_hZ!!:2_*ڛ-N+pu[w Z4%mP$i}!`gTf b: >t0 ;Ogܝ-0O+o}fcMȁ۰Y }N\4OӬP>~5 /ϲWoSrUp 6"7u/Z) O#rj}" | vcb$L0hW~j'Ls)gЊ~gZ?~DJ#H"_Mm| 3Uz:]m JftWϣSuf,HUv,w0d;U?'̬1Y|E"9Arbi`*x-ge"p_Ԫ;_N01rk|*} 9Qa%)zD Cʻ3/꧍֦ч_ݭRT#_qsu1>Z``Wp c6F%OwG |L}~ۻ}ϧ3 s@R'u+=4~^3#ey,K;LP_9;Y)ixf knקR#sي6EoS)e6"?> KeDxJQ:F|%h~ө;;;(}ğc08cUc$o_ άBQXy"GYD} Y1&fE|!X]7m3z-3ftm1p IM&9 H+ۑ _U~}dCs|w Lh]3̚EgndnDgY 4yīrYWa_?G>N0A>U/xw Bb=#p*,7jw3f Ocx|=JWW"S`~M[S`k;?k;u^El3vc4W-Sd]{%DT}I2  LFOo߮~I?cBu/`p=x<ܗL3ẌS)~^M'53tFu&B^?Qsf/B1 }LgyOKnߦn1~OӼDvJsg7[>]ݓ'T:͜]+Op(o]ϼ|h5y'vs@[w~g JKFE ϗD3O1VOEgk Ŏ{AX8^?j`3n?תX.փvkب0Pt*((M*XJ(pN]i$ ܁SEVW%)U팝tj{M:XNl+_,K%U7YV[k`+}bYiֵ~=~Zyk5Qpn[ U@gw)7O ~;OI].>NhLgt-[Fƿŧ';+t-[7ZV` [1wEBOkδbSS֧kBu _T/A})yQ$g)I 6W|j,{$XQ a5TLw_u֊bM0)Ap?u [?H{ מXgsLK |=~9D8Ħ3U ݺ*Z,fDۍfs0Bi|4+ w&)&5Hh`$Azkur3,t🃽#gD9k'C43.hgk.0b-Z܄:E2G$}k()Erv3GHR b>3_J2O/̬4C1 h>&hpJdOTx ?;δ_R'2,utp=s`dԎs 7`!@XM?k]41v'RL~M&~;` ku3< FԺ=ݬ;|֙ވi}iA%Ye8mv4+D޳H"H^-wSw|[,d_#H[?rimd̄cZh"]J1-IH8 iAǬnV{ &*lY&SUcS #7ފd~Z'l֎uZDkVJt3𢡄SAl3"l^ k!6{Z gNmBNrZ`՝|p'ďW% eO"1fNw%^fOޤ-DNb698O!p[YEE (zlF(̀ρf$Ť&7Rx ?d<8R1Ho.~_NG]cm3$X~f;xe- ~-F[Q_~6>Y(2xun5:O>I co0Zi73^gؙ:%*.Nף?FAC3f\c6G)1py +fLiw觍N,P:tvs=M(mm$s4{&R,XC>Yk Rtw(:n!a`OUM?͸>(n8S:}3<IH)Zچ$-,T#b^Wk=O-ѺyU_TN_ju I'r^yCH)@Jy"X5ZSޢ~mmHi7{ ߉S0UzoNjs(eT3y{zCa|#JG*_շDBS$Q޾|< L4Pt-dIJ t& si:7R v` 8$d2pH힔z]-'X~]5xXSi~W+wT"X>::fyZ$+NA޷MOwRKKe:;uy#l>G>#OoNj-T KԍZ5 >;m Y'8IQNSHЩoh^cH,rELTרSJw$Cʜ:ʻѩdCF+uLXp"oUք&L}5ٔi8SpV g2csn [8=+ܞv)%RzmJ]k֨Tjf0#qͣ`V2ʘb|j.%fFp cM[#n?>eFs֘(̾\e?gGSlj#k9[UJ|"bje|)kY.v@̣|nkRMǕ)Kd0V%eDf1972 G*<^s1+GcنIgL֊$>}<&|y{̜bz={Z.ŋ͹ȣ̠f-ei.ي}\6zHkl 4> ki,6jETr*4.Yõ8}|'pzy]5krsx3YWGrs_rpzɼsBv3Y '}ej!e~i4;&$b޲NndބO߃$;pKw)3p3y38|M]br%ۀTϗm}eܓ#ͯ9#AWn;+7&܄>6_їM%323[ޘ%Nis3.?)g6_<nPWa 5?%+s&afRRr+\~_qt/_,皒pFNB\OJz>nK.ᗹ]%`s_\8\Ó\C8\^ጌQ|VUns1ns  m fsn&¢k:Wpx(q8/v_3-4_=,U3oIzr\Ӟ$ Rܤɔ侌9,!.i-sI8|\ȹQI{8cpĠYP-m~ $4Ov~/ԫhgD !@I( &4&T6-=`_>AE!j!4փ^П,G asd3B$“P*u~7 5xz`Fݺաf-׫Fs-mG5A9xg B} $@x9a鞂*P  CNToq(*ThN. /B_xBG oP\ P %TPC x :A"42mYkKcS63ib8āP`(Cq(ď#Oxp(#q$3(cp q8O$q N 9~q:NJ8gBeKWTy8|\q!.CM\K.P߳l\ ϑ\uq#YqYz m}FVENV%AV$wxh ߈o4+x5^)+% ݲEф[ E"@``y=G6?/Ym}ѱ E.YBUBV(&ԃF_@X a>,հ ^8 g*A&aao֓eYM2B}X&e-a.nTnİXv {e,{ &ٝ anaCYveIrX&}²[ا, g#HO-la{ FFrϻgf>3|FL32gdT}F32g /}F|32gkai7>#}FY3"ž|3gf2>3+|F~Y3gdZu>#|F63g'yB֔>#?lgW>#3gd>_W93sgc>#}FN93ΌfM9793rgy >#|F.\3rgM[>#}F33ʃfHa)82G̜fF.2#יFSi4i .'9FUkzTo5H VCjvG1u\P')uZQg9u^]P%uY]QW5u]ś$mt׹RQu@V5XjEuJTxS zw!ƩqA-Q[ 2T2T2ĀcerX9\Vn+g=nzF-wS+Y{LrZ%% {S*r[}伔FZQVF+meb̷?+!" m,m0˱\˳BZpﲨo}i=eϪdUxV3,5G}֪ujڠ6&ڬnS3՗K{";J̭U>J}IKRL-W+jZV54\ 5jf72kE֙Zj70?93E6yv'ޅa y .1 Oh0Fg0МaLI0t3a|AK_\7d,E'[rX?JXEc u6FOV/dU~]Cp9Spΐ9\Kp5܄[p]! zY_(_ dCl$_eT6沅l)[ֲl+|M&Ȏ|]vor#}r< C<"c4!414)494%45yhZhzhFhfh?}{|$ɂ)&ԳwFأfYuށCS)Sh8ΞN:~ZYV|^ڎX;q|XH8cu q_s:t;?LΏmYﺷ3_0\ h,yd{ GyF!܍{ EUD4d@G#=@=D{QFhjLF+kM֡CT98'sҧʉ̜9hbiJIߒʲ e5Y !k%ρ wCY,\v.S}Ҟ%=WόЭtNMxΪ3k7{]_ha)+K+;:^D^sL]ڗHSwʎ" ^e2y^f/eyٽǼ^N/y{^?0tK^w?]Lw#ws~ǘ3OI13c̿Sf/;RDV6FHQWԇ=h*ZC!V⢽h%k#PJ#+&@SZ.2z7};0H+rɏ0$Y{OTI*RE Q* T+`vZSᬝN/Mپm1] D"[p+020Z< &f9l`a`&^ M{D!тIu x]V,O bE@X,,*qbC0>/6KK3)X1XQ,6-bkv9X?X_l 66f``{;bi):vbINwq8q"ٕ+RMܞ7;*> kRo\~DS>" G>ZӔtK,Ml[Ntl B5EDrwD) 9ZXbolvjgۏ9v.;kv!].jqv1Ub-b/8,8.N8-Έ8o)R7-u[Qw=u_%dYKDӡ +180Ҋ$V:Å*P%ɂxI'NAig sPl#WYa_6})B}ɞ/ei*kzd]X#{]#ܯ ހ0 q"_\ghpsps939\~qO㹧MLeT^W^?C~&"D;ӣʱ飨˔0M0"\ Ècl3/E3/A%ֽMav\u9 9/;/μק4#q` !i'v ;WК#AOŹ<ߓ?KX,c X5ր/*W`5y$XC<[i ;i]Z U iuYB!`vPe{[W9~QcDZWLj@}(0MBE~zwѕW:IF))-.*1e3!vHll4ۡ ۡ0C!vc;v(PCleb;d~Wzj 1gapD2((2)QZNkbHN31_,+ZIl#nEq]%2#  >?qFl"Jl*ʰl&ʲ|Uc\<Ų(ϲ<#[J,ۈ*,ۋj,ȣxX;B;";x/igzFC,`:Ip,#K NQ,A:b 7kKAc᫢asQu$a+OZfۘ 8k!:;:qFOת(\YsZKy I珉555~Ik6mjO~J9~S[e_RB$E.qs%=ğ\.<~lGʷOX+l!$㣟B1(>9K@n:\_71yuxJ8}Ox~/`=;y!` ! #a`O '  92†֪>Fx<|"Bx^sqUOCd,y֓?g#2U&T<ēdl$ 9x>hWq :qd|dʆd3lNaM󡬧:ϯdEN$'$ uxWfE" aΉga-GGx|=e<'UN9̇)NZ!~eAd02  @Ad@Ad#D H"$ H"$ H"$ H"$ H"$ H"$ H"$ H"$ H"$ H"$ H"$ H"$ H"$ H"$ H"$ H"$ H"$ H"$ H"$ H"Z4ku=!XKĘҮl̓y;ǔLh'Y%"dƥH9<SR3`ip:G`C%,'q 0?|LfHB1omKG阮fd(}ǔ1I1&HB1%$q><2~\0N$6 @`gypHdIPV%;>?OMcpQB iczt=ڇBN@u`DDI/Ҵ0mL6GqNjژ"P/M!Yfa3'#C:H8XϝtDfL5ifbrg4g1f=t^υ0 -sЋ@-N rzN#v'ºPwTCL R~!K_ gypYۖ2+ORw]Uq|191G+6qyנW@jϴOK.!gK![{(ei&[9xr`͆W7-oMJ|Oogp|Fk& GC5$-]d(\|w*^ 5_U\ҍg /_/wkbKS{u.ęmVKw$~tn#q-{wRjh=׺'h5]O.l 巯=Mj؄g9%6Y^X?.cR; kIt-b!LvzB"A5 %l!d_N[a=J׮&QkVstOdgW__W`u>6!{l;R}b)e r{8p|>뿛eҡkc_Z廵^dĕ~ُ{ Ѻ56'"VN;vz8b?pJ.sk= ^[= nzyr1;{ݒ?'jЮ`cIo!\b_ʭB z' PgYB̲xȍGtǧ}&oE<QS*yJY]Τn+k ׋_XE2eMKWKjhaTvUOjRu}i~OxME͓"qșř\30Ip %0?@ܗqOƝ ӡjШ >E1\H&o`îG6A{oPmϷi(w_!n]ѧហ1Hdœ6"kw nhb9xCwKkB^`ֽm޾C;vZ5 sQEM};,EFGG/xi 0/w̕F^p5#7!1艄*Lmۗҟ#JabB_I܇2ؘX(IPGZOs:xi>tr.}"ŮU̻ᳱ$Iއ]¤Ǖ/+*[=;E5WŹ[!yϐ?!ODnST`O+$0χ `#ˆcIn--LW]KעM?&GBXjj-><*;[8VlldONrˮ`eJb1k7̌IE]4=:6KWn=OsObew kZ͹ WJ݅G7qtgo"+E,f9mn󬯪̦דNIיvgEgDeꮓyv E#p?ì6K-9[4nКwvsq7]qNE~گx>~^έaiY]V lA3Hklss꼟"k~Fk퀁yU]@Ζ;IOj嵎]p\s3[%r|uOf(m&.#]2|e۩&HGr32;EBc˿{i>FR=bH]P&H۷CDxAH,K]n׀:tɝ뮩۳I 0j{EqA퍭y'BVx~_;υ?*]NDP):ZفaCnҠح)#$ӨؖEcm9c .&řGCAi,0LGNՀ*D8_+--m/!|]ko_g?~4AR-OZN4S˅+騴R+˔8eYff>YF: ih4ypLbpġoES{ǴRxM5ِ#Һ܃|6>D}q 5LJBۧ)cLigfQz JWXlaKvf*&WZ=I}k4?cËU%Lo=Y$rM`^])7\ҩbKQ2F%{b޹*&MBg:K0&, 4ia&yy :h~6!b:NALs ')󟌲YxrK\tS0=G7,W?ڇE[ yxxݸ{K*P۽e->[P$䧸S_-X#r([s3ɢ碞WmtJ3~n͓zUΙr0Ie-huiEdI|6p7섧TsY'5~Y0 1YLi޾ T7(u~("vՌEm/ZWy6jx=#ezLs7%h盥^=.̯shJbruF+>0u8TTuVi=O/Qe$tN,r;7,ڻ/d2~IyQad~s"@YJ|xHLk Sʖ#3DulYmؓ-:Zd-'>/KsS#xW۫?3a&R~/~|vdqx[glI\ɲΖ8;+PXC9r~*ۂ"|\k}WTs͜-JWmmEnH1t~hsdw;랥%_-/5qw>Uasb9øӪuW"{JKN[CWnx?EyT}JzZK ks-k^DЛ~;ZAU{91麝󋜨Rŷ?ՖU(Rdmԟ19}Uq(fhUY_^&'ígmйVA &ɬ_ .hȕi5~u+6r'#)kKc[O?k&X#IѧsQ+&+ɷږ/Zy"/}Ľݛ(+dԋ9"<ͬ$soMc ,աzóJ2ZHX#p$]tû?˿c// ׾/'3u?%nM*̂o$pQR%7>~ډ |9^H": $0GB! />x.^O;+#.KP!1AYLKzc~#u?oe(9 Oo{?oaOO%c3u[]x'޼+zzóىXK=Oo:s#bw2|+hdyh)}th{RG3T҉ns^GwEbA R{޸X]V1^S涨LVѱD-(͇9夜xkNo+-bL-&[Dk:.+y,zO3EU+c)>?߷i|pFDFhj`G~O Je5pQEYYyMbƭ *~==̲@#fHمzB=SlzNm-Qh0߀N!]gRE2{:\eٖin$ƿ'$+J$>Vx-R3Uh`L4z+vFիśdKY[lC8#ɇ;3{".ַWְku.`%hL%>L*vhޞ|ܳ)fHF3{uHF[w} endstream endobj 92 0 obj [ 0[ 507] 3[ 226 579] 17[ 544 533] 24[ 615] 28[ 488] 38[ 459 631] 44[ 623] 47[ 252] 58[ 319] 60[ 520] 62[ 420] 68[ 855 646] 75[ 662] 87[ 517] 90[ 543] 94[ 459] 100[ 487] 104[ 642] 115[ 567 890] 127[ 468] 258[ 479] 263[ 479] 271[ 525 423] 282[ 525] 286[ 498] 296[ 305] 336[ 471] 346[ 525] 349[ 230] 364[ 455] 367[ 230] 373[ 799 525] 381[ 527] 386[ 527] 393[ 525] 396[ 349] 400[ 391] 408[ 527] 410[ 335] 437[ 525] 442[ 525] 448[ 452 715] 454[ 433 453] 460[ 395] 853[ 250] 855[ 268 252] 876[ 386] 882[ 306] 884[ 498] 891[ 498] 894[ 303 303] 1004[ 507 507 507] 1008[ 507 507 507 507 507 507] 1085[ 498] ] endobj 93 0 obj [ 226 0 0 0 0 0 0 0 303 303 0 498 250 306 252 386 507 507 507 0 507 507 507 507 507 507 268 0 0 0 0 0 0 579 544 533 615 488 459 631 623 252 319 520 420 855 646 662 517 0 543 459 487 642 567 890 0 0 468 0 0 0 0 0 0 479 525 423 525 498 305 471 525 230 0 455 230 799 525 527 525 0 349 391 335 525 452 715 433 453 395 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 527 0 0 0 0 479 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 527 0 0 0 0 0 525] endobj 94 0 obj [ 250] endobj 95 0 obj <> stream x]j0 ~ CqK{cClJfXd8d/t0 }i'7'8-B'uyv2QiuN84UנE{r!{ayqBJP x5.ؾus|068ȆFTu%@*($Oߨ~_xX{,yJCT>?!oP endstream endobj 96 0 obj <> stream x{ \TUsaM°o3 ( *%0(03Ro- .[ˬLU+-+L{f00 r9Y<9 .3ǫqq; 獞 -XЄT^R9gp C%ڒOhaqXapmfba啖9!o2 N{INCv/ \RJ1q6@i&‡Pn֛l~n8vY3λ2ikY viׇσR<1LvNYGZ_H9v Cұfܭ4r@ U]0@*>DGIJ׉1n{Pʸ;b1aTˆ 38\.Ie䍅JEGh&i f/C_i'*߭_M0=RBrk{理"{KX"fYwNg_z*A25D9 vpgDpAtW&u!;x z'x7 7\91!BrC0#r!@b("*A a#!Q ш1 U8xH@LHD$HBLd2HHA(@ b*`8 A3 a`8p?gHt012 Y0q$/(88"fC688r!& NaL ya TĩPX4t0^3ZցJRR(C,r[(f!B<a6bT VBL&9A5b5E3-`AZ,BbA0q.(·oq4 6xCðq1,A\K24,FFX+a%*x&&r"(F\ !>xZĵ5<O"> SOW4 <Ќt3ql俄 q<__͈a Vĭ"/!2 X؆ #n;`'9W_]v#`xuqG~88x@|?7!x -xކw߁w.{p0pE< #??cS>cH##/pDB ?ēp F4A<mi "Q8"-|{x~@.!?K3?Q~A/p2\UkpW :{﹁ xڑA'QXq( vXwNn>'J߳I仱gvwd#^ r{ ݵO>gßzL}>&7jع-lpsD$wa[lzLw1{I^)yv\f1z ;83rՇq)K U }o3}׻^R`-zfw_rz r왭Cls/ O.lꙭ w•޸MpC=ݻxuMwb";HO)gvwxuMw%-{fwگ~0T}LIAhS}Cl% LpI=k}5s/h4gvne14 w^3 뽟>ǔ;H;83z'"{IyI=G&~t5/ypy=k{?1}K*)Hms𨾷(虭{? }{bM8&⏷#C!/oW=nrswtB4 /~DB/Tr.{:x4Æ 2h@D*!>.6&:*2"Rr֣JLTLe!gHEЌ3fBB[YIeY[ޘU83zy|tD4aOdΨ_eSf *X,mu⤂̀8+)auU J2R*3r%@V:(K3 Pr3>s|bKYN66.͓ XX}`[&|dQHǡ4+yEr%U6,S4:(G(g7Z!>df7 gqe6_'4op~KZn6Ƕ '箄VhuνY"hatjRDRЧ@.a*$Z#b:d5* |UPrW#@yBwΑ+@ qr+ְZcbfh~@|\m+4)8|`"V[8X xy1c]88`hTVH(9Y5Y(YYry#y^VYĭ?WGV`+b<;O=iZXdmv~=>](€\X{!!E d)G@lMm,$2d 7j?,[ { Q<>&NS( ʎYi;-iu/Yp AL# xd+'㟆xly!Uqp^ xL /(gɗ0I0ˠq,!xغ?O>xNLj\@Mt0vf8! dVxBӅ72Q'Qy~.3a+Z}BYW G<[_o;R/A{њsX x5:9u>Lv,7*a,h:Xy2ƙYOHsƏ o Aj;fzDYd B1$,DVՄۊ7+8Y8Chkѐd2Iʈ%VE#@&2e0Mia3m/`65[7wُ/0NJ"F*LtItY!Vܾ#c:|^ALLQ oՠU&zhx}'xUh1Jޡ +8-%"!$$QxMq%BC?x _he3+Sns Gg%8(6Nge- IYv=`1jу&+wDCčxY;{g%IIU*:`;-#YJ^"X901 D*5 $3TVGH)ϰ X8""yDRypS&hō67:a3}3_H\ lbLj ZǘTnD3/V&`+6gP<+i?pn2p|)ڵ`aŅLl"l}_OnLFd~ ~E>LUCGg8p7gOypm*eY! T=Hǂ\"ֱ, ɢS|csƷ(W4NT'& D| |a. RV`wѿjE=fW*iÉ{jjCF ?09 RO2Ԟ}(@2BN3 餌1n8o&'$h4עf͸HaFE g+ɉA.:AưN"G<O\B $ He1:LXvhDi?sf^N('׷; S\nx=qxZZZ &^CK|qO.OjC<${C{fsI=["do;:̺ ۩_!ZQZbU WE2 YR UrʠPe+]>|TVbh||=}||Ho$с*/$ۋQEF8NO$s W~#!;qCCF,}Y "-M@TaR'vsM,QM !n>^! ?BBH2T*񺭔a';S¼sua'*ۯ7ޟfk-7Nhf-l}+H4 M؟ pN `CÔ$D$#$c*:ɩHw%/D%q{qWE^ )EEŶM0|/*ܨ|Ri\DDFf NFF(C%^>lSdD%'fXF%fY#ý慩43gz.7}/~{<ӥBٙ ȩ?,T-w]3>!rYm튣'/Y 5HܵkUQtĕӊ3= ^Di 0l40Q-u6%jJ9EU81F.6M @F&.(Rr N<"I!=00ZHl"͢E0&^/ '7pjԒ` A(xd{/^yCۧkW4"n`bC/~~9)xP͵5Qe̢zpÂ׾F/>^}g s}!d7dA ?'C"6MAG#bǜ8cǞX{I=O&U yn.&O=uLo]g@SoyNr̰Ӣ.uNW WOL3rLFz 9܄ܸ1Y9yY\ܬY9rgy*k\ rkhv`qYǥS/ SFg+7ʻŧJWQSMg%.5Uqqn ќXh{_U{TV/FRmqE<6AX̪6c]UQU(*ai<k, Wf)WnOGRȩ*q6FJuTcJ-[ީ ʰ1QMtN6r:Z*6Br0^%Gs*6:w֦S3r T :.vmWd= >첄^(d2w]"EZay«^ cL뢢+Q тuT3!gݴIU!D`!0F❁@O@0sF",! (Yx|p9 mcZ[zk2Xk]) #h=:KLt)A):ڣm, =ɵ tVU`T[tr]Ė p*a+[nPRQ.z:zҫ}K^rkf Ug Uvt` I#osUtRݼj[Ìv}UjkOΕO9jS/cgRg&:ڣӹ;:St7ﶻw?uE$JeF"bm-(xO,].]V̇,}ڄ^ iI9 M"qY$u5M|lrRy]w!Nqܘ*]Bb:&(:eyfAh "L!MGr_⒚K;r~:yuvƒ~_~8yCe Vg]tau/0_k+;77~W^잙T6]۸ywS=RtAon篇䒽3JL`\(Ds'?U[ΞyqE̛C}`fږ%VxCojmm"? sa}{? ;qhu3ZL2Cї־kο?|e!ۗðP/\_"Èμ,:)O0+hz‹dj >t,NQlߜXmoZehN-XE` W%!D>z8c'HmV׿+x#_'cox7,z^qNHX[bkL0%.iyʒϯ& xsdܗwiy{jOv>o-ӳv~2$7 %8yus>K}]z<̌?NGuJ8BUxЈބ e^䶉Q|C5,8Ժ^xz["|xM=g77怘h?:zw~j N͘_:`16d g^^:c4no:6EwnBa3K~38Rt]sNڜIUj"#_JO\7oYxXk,ڬyr[G_L;gd3;%zʹ׽FʏO=Zܭі#.m}pOX0Cdl<^_N$GddSǨ#i2ZxN?o:.dJi} d鋜\M~k{ۗ]>篏?\v{%G42?kģ["WyqtS?񗀉a ?VV^sNuǿxAsӯ,s[7>1om˵GP0:K;cuktv/qxuI2ymxsyhܜԾygyɕG>Wkܰ+qˏop BZ6_{|Ֆ}Ϙwi^R7q ͶAXaWuNjzL+sn3l /TIh*L ХHY( " HSDP#EM+^:"J]{g?g?9s23ya VpH4|+y=m5Y$&z\O  h&dr7Or'^cJs퀩hVI2))pՋ&1/4f }[ I u.kptVdߜ>蜔"إxJV{Ew oB^p(ċd~&8)% !ĹcTpV4a46͏EW+N6,Z J8meRYTc#bZs-o(Oivu҉f.$TBQ($&ੈB%a7X,ιP>Kl0bNg<=g-Y7e7bb;k⃦FM{좑i$UCk3u%|;kRw(szp-kq_+ؤw' 53MqG"k-08_TKpbJgt܋#ڦǤԝȯv uR}MK5Ck}aP2} n\l5>2}<@w)N5FPeQcܬꐍB#o%ל0żxVY:9}QEeXl$ֳ{L"X<$! 7 8/tnQrK|ַm67.w):ʶd :O uu]m}K`ώy1yʒ)VV "R5hSg|!! c-*to눏 Z f-r5Bnmd;}=cIE%[t*2w0iÓ!ɢfXEcF{ɫ^D<ܥ:fYBZgp&x=\̚B@5* |d̆U{3zަyoޛ.]~ gUj'(vjk ?S@ɡin MFaZKYIJB&cvhݫ"rm!ۏދn}XcD&?//x}T_sF윜d#!A)]N_G^Qxrod-Ky"H_CZhgpkK@FiV\k[Mc2v'f==?oS_Rτ}MИz<J\d>{'Gߎupד!L ZSن$"oR6 f޸704gؓy핟/vT J RsbAitt0̷;?/wWQms2 @jˮBNTPԶ(]}﯋>?7Hdn[3!:{2Afd+>ZFf> ]ӬI_06H^ 9:M+WUX|>%`ȢSdrD]R_œ@=݁X <2\ zLt٢b@WXF ;պ>VhgV].5O֭?5Ei`A=t'Oixh/3Wn,3n;beUcXcL:IQD 4v:aZPd;mzfmg+_Z@lD(:o%v|_JWk]{x q  pL`kɮ;Y2XI( j]58BҐ TY5'&4Wc~d!/j:1@$Yg2St3GI% YSNli{,t;/>nqETgd'p"6xn2SB_AO endstream endobj 97 0 obj [ 0[ 600] 120[ 460] ] endobj 98 0 obj [ 278] endobj 99 0 obj [ 278] endobj 100 0 obj <<826F135A4A8754419318A6C0A9F92544>] /Filter/FlateDecode/Length 273>> stream x=һ/Q*䀹J]ު,&}3 &1U;[+)a+p>ys1Ʈjg15NYDH<OX+Ap!TԷً(| i"0mA}a3Lf Y2kQ!uMF.4CZ"8 A$ 0)a4xQ q)[JYxdߚ%gFx'/v~x(+ m8 endstream endobj xref 0 101 0000000033 65535 f 0000000017 00000 n 0000000125 00000 n 0000000181 00000 n 0000000582 00000 n 0000005242 00000 n 0000005415 00000 n 0000005659 00000 n 0000020368 00000 n 0000021087 00000 n 0000021256 00000 n 0000021496 00000 n 0000021628 00000 n 0000021658 00000 n 0000021818 00000 n 0000021892 00000 n 0000022132 00000 n 0000022306 00000 n 0000022545 00000 n 0000755641 00000 n 0000757235 00000 n 0000757289 00000 n 0000757343 00000 n 0000761770 00000 n 0000761894 00000 n 0000761924 00000 n 0000762076 00000 n 0000762150 00000 n 0000762380 00000 n 0000762540 00000 n 0000762765 00000 n 0000762930 00000 n 0000763160 00000 n 0000000034 65535 f 0000000035 65535 f 0000000036 65535 f 0000000037 65535 f 0000000038 65535 f 0000000039 65535 f 0000000040 65535 f 0000000041 65535 f 0000000042 65535 f 0000000043 65535 f 0000000044 65535 f 0000000045 65535 f 0000000046 65535 f 0000000047 65535 f 0000000048 65535 f 0000000049 65535 f 0000000050 65535 f 0000000051 65535 f 0000000052 65535 f 0000000053 65535 f 0000000054 65535 f 0000000055 65535 f 0000000056 65535 f 0000000057 65535 f 0000000058 65535 f 0000000059 65535 f 0000000060 65535 f 0000000061 65535 f 0000000062 65535 f 0000000063 65535 f 0000000064 65535 f 0000000065 65535 f 0000000066 65535 f 0000000067 65535 f 0000000068 65535 f 0000000069 65535 f 0000000070 65535 f 0000000071 65535 f 0000000072 65535 f 0000000073 65535 f 0000000074 65535 f 0000000075 65535 f 0000000076 65535 f 0000000077 65535 f 0000000078 65535 f 0000000079 65535 f 0000000080 65535 f 0000000081 65535 f 0000000082 65535 f 0000000083 65535 f 0000000084 65535 f 0000000085 65535 f 0000000086 65535 f 0000000087 65535 f 0000000000 65535 f 0000764582 00000 n 0000764853 00000 n 0000850471 00000 n 0000851047 00000 n 0000946484 00000 n 0000947158 00000 n 0000947761 00000 n 0000947788 00000 n 0000948088 00000 n 0000960399 00000 n 0000960442 00000 n 0000960469 00000 n 0000960496 00000 n trailer <<826F135A4A8754419318A6C0A9F92544>] >> startxref 960972 %%EOF xref 0 0 trailer <<826F135A4A8754419318A6C0A9F92544>] /Prev 960972/XRefStm 960496>> startxref 963152 %%EOF

Sorry, the requested view was not found.

The technical reason is: No template was found. View could not be resolved for action "download" in class "Px\PxJobBoard\Controller\JobsController".